Rmu_sc0003653.1_g000025

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003653.1
OG0013423
Physical Location & Seq
Reverse (-)
105958 .. 106648
691 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003653.1_g000025.1.cds

Sequence Viewer

Length: 609 bp
atgatcatatgcaaatctcaaaagccctaccacaaatgtgaaactctgaacgtcacccactcttcttgttcttcttcactcaactatgcctccccaaaccttctctcagctggttttacatttcgatccaactcacttttactttacaactgctcaagctcaaaacttccatcatcaccactttcccacactttgacatgcttacatacatctggagcttcttcaaagattcaagaacttgaaggggtttcttcgacttcttgtttactagctgatggtctcacaaagcttgacatggaatttaatccaagtgacttgaattgctcatgttatggcagagtctacagaaaatcttcaggtgagtaccatgaagaacatgacttcaggactagaattgcttttgaagtgcctgaccacatacccaatatctgcaatgagtgtcaaaaggctaatggcaattgcagtgaagcattgagatgcatatgtcacccaaaagagtgtaaaaacaaggtcatttcaaagggtggatccattaattcttttggttataatatccttgtttctttgcttcctcttttagtagtgacagttttggtagtgaatccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

202

Amino Acids

22.1

Weight (kDa)

7.91

Isoelectric Point (pI)

50.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013423)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G44716 AT3G44716
malus_domestica MD03G1135900.v1.1 MD11G1158400.v1.1
prunus_persica Prupe.6G120200_v2.0.a1
pyrus_communis pycom03g09180 pycom11g12900
rosa_chinensis RchiOBHm_Chr5g0054991
rosa_laevigata RLG00000034954
rosa_multiflora Rmu_sc0003653.1_g000025 Rmu_sc0004354.1_g000004
rosa_roxburghii Rroxscaffold_1G00025520
rosa_rugosa Rorug05G0289700
rosa_samantha Rh5AG359800 Rh5BG370800 Rh5CG393100 Rh5DG384600
rosa_wichuraiana Rw5G033850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 549
AccI GTMKAC 1 cut(s) 342
AclWI GGATC 3 cut(s) 120, 522, 535
AcsI RAATTY 1 cut(s) 299
AcuI CTGAAG 2 cut(s) 339, 367
AfaI GTAC 1 cut(s) 365
AgsI TTSAA 6 cut(s) 225, 233, 242, 319, 404, 519
AleI CACNNNNGTG 1 cut(s) 36
AluBI AGCT 5 cut(s) 110, 159, 218, 272, 289
AluI AGCT 5 cut(s) 110, 159, 218, 272, 289
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 3 cut(s) 120, 522, 535
ApoI RAATTY 1 cut(s) 299
AseI ATTAAT 1 cut(s) 534
Asp700I GAANNNNTTC 1 cut(s) 352
AsuHPI GGTGA 4 cut(s) 46, 168, 371, 479
BamHI GGATCC 1 cut(s) 527
BccI CCATC 2 cut(s) 178, 269
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 2 cut(s) 269, 390
BfmI CTRYAG 1 cut(s) 343
BmiI GGNNCC 1 cut(s) 529
BmsI GCATC 1 cut(s) 467
BpmI CTGGAG 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 139
BsaI GGTCTC 1 cut(s) 284
BsaXI ACNNNNNCTCC 2 cut(s) 74, 104
Bse3DI GCAATG 1 cut(s) 439
BseMI GCAATG 1 cut(s) 439
BseMII CTCAG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 284
Bso31I GGTCTC 1 cut(s) 284
Bsp143I GATC 3 cut(s) 3, 125, 527
BspCNI CTCAG 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 529
BspPI GGATC 3 cut(s) 120, 522, 535
BspTNI GGTCTC 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 439
BssMI GATC 3 cut(s) 3, 125, 527
Bst4CI ACNGT 1 cut(s) 589
Bst6I CTCTTC 1 cut(s) 67
BstDEI CTNAG 1 cut(s) 106
BstKTI GATC 3 cut(s) 6, 128, 530
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 3 cut(s) 3, 125, 527
BstNSI RCATGY 1 cut(s) 201
BstSFI CTRYAG 1 cut(s) 343
BstX2I RGATCY 1 cut(s) 527
BstYI RGATCY 1 cut(s) 527
BtsI GCAGTG 1 cut(s) 469
BtsIMutI CAGTG 1 cut(s) 469
Csp6I GTAC 1 cut(s) 364
CspCI CAANNNNNGTGG 2 cut(s) 47, 82
CviAII CATG 5 cut(s) 198, 295, 327, 368, 377
CviJI RGCY 7 cut(s) 25, 110, 159, 218, 272, 289, 449
CviKI_1 RGCY 7 cut(s) 25, 110, 159, 218, 272, 289, 449
CviQI GTAC 1 cut(s) 364
DdeI CTNAG 1 cut(s) 106
DpnI GATC 3 cut(s) 5, 127, 529
DpnII GATC 3 cut(s) 3, 125, 527
Eam1104I CTCTTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 67
Eco31I GGTCTC 1 cut(s) 284
Eco57I CTGAAG 2 cut(s) 339, 367
EcoT22I ATGCAT 1 cut(s) 482
FaeI CATG 5 cut(s) 201, 298, 330, 371, 380
FatI CATG 5 cut(s) 197, 294, 326, 367, 376
FauNDI CATATG 2 cut(s) 8, 482
FbaI TGATCA 1 cut(s) 3
FblI GTMKAC 1 cut(s) 342
FspBI CTAG 2 cut(s) 269, 390
GsuI CTGGAG 1 cut(s) 234
Hin1II CATG 5 cut(s) 201, 298, 330, 371, 380
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 3 cut(s) 229, 339, 601
HphI GGTGA 4 cut(s) 46, 168, 371, 479
Hpy166II GTNNAC 2 cut(s) 266, 343
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 3 cut(s) 213, 233, 385
Hpy8I GTNNAC 2 cut(s) 266, 343
HpyAV CCTTC 2 cut(s) 110, 236
HpyCH4III ACNGT 1 cut(s) 589
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 4 cut(s) 12, 432, 462, 480
HpyF3I CTNAG 1 cut(s) 106
HpySE526I ACGT 1 cut(s) 51
Hsp92II CATG 5 cut(s) 201, 298, 330, 371, 380
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 3 cut(s) 3, 125, 527
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 5 cut(s) 96, 198, 342, 370, 423
LweI GCATC 1 cut(s) 467
MaeI CTAG 2 cut(s) 269, 390
MaeII ACGT 1 cut(s) 51
MaeIII GTNAC 4 cut(s) 52, 311, 485, 583
MalI GATC 3 cut(s) 5, 127, 529
MboI GATC 3 cut(s) 3, 125, 527
MboII GAAGA 7 cut(s) 54, 63, 66, 213, 243, 345, 383
MfeI CAATTG 1 cut(s) 457
MflI RGATCY 1 cut(s) 527
MluCI AATT 5 cut(s) 299, 319, 393, 457, 535
MlyI GAGTC 1 cut(s) 348
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 100, 582
Mph1103I ATGCAT 1 cut(s) 482
MroXI GAANNNNTTC 1 cut(s) 352
MseI TTAA 2 cut(s) 303, 534
MslI CAYNNNNRTG 2 cut(s) 36, 475
MspA1I CMGCKG 1 cut(s) 110
MunI CAATTG 1 cut(s) 457
NdeI CATATG 2 cut(s) 8, 482
NdeII GATC 3 cut(s) 3, 125, 527
NlaIII CATG 5 cut(s) 201, 298, 330, 371, 380
NlaIV GGNNCC 1 cut(s) 529
NmuCI GTSAC 4 cut(s) 52, 311, 485, 583
NsiI ATGCAT 1 cut(s) 482
NspI RCATGY 1 cut(s) 201
OliI CACNNNNGTG 1 cut(s) 36
PdmI GAANNNNTTC 1 cut(s) 352
PfeI GAWTC 2 cut(s) 229, 601
PleI GAGTC 1 cut(s) 347
PpsI GAGTC 1 cut(s) 347
PshBI ATTAAT 1 cut(s) 534
PsiI TTATAA 1 cut(s) 549
PspN4I GGNNCC 1 cut(s) 529
PsuI RGATCY 1 cut(s) 527
PvuII CAGCTG 1 cut(s) 110
RsaI GTAC 1 cut(s) 365
RsaNI GTAC 1 cut(s) 364
RseI CAYNNNNRTG 2 cut(s) 36, 475
SaqAI TTAA 2 cut(s) 303, 534
Sau3AI GATC 3 cut(s) 3, 125, 527
SchI GAGTC 1 cut(s) 348
SetI ASST 9 cut(s) 54, 102, 112, 161, 220, 274, 291, 361, 513
SfaNI GCATC 1 cut(s) 467
SfcI CTRYAG 1 cut(s) 343
SmiMI CAYNNNNRTG 2 cut(s) 36, 475
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
Sse9I AATT 5 cut(s) 299, 319, 393, 457, 535
SspMI CTAG 2 cut(s) 269, 390
TaaI ACNGT 1 cut(s) 589
TaiI ACGT 1 cut(s) 54
TaqI TCGA 2 cut(s) 124, 254
TasI AATT 5 cut(s) 299, 319, 393, 457, 535
TfiI GAWTC 2 cut(s) 229, 601
Tru1I TTAA 2 cut(s) 303, 534
Tru9I TTAA 2 cut(s) 303, 534
TscAI CASTG 1 cut(s) 469
TseFI GTSAC 4 cut(s) 52, 311, 485, 583
Tsp45I GTSAC 4 cut(s) 52, 311, 485, 583
TspDTI ATGAA 1 cut(s) 384
TspRI CASTG 1 cut(s) 469
VspI ATTAAT 1 cut(s) 534
XapI RAATTY 1 cut(s) 299
XceI RCATGY 1 cut(s) 201
XmiI GTMKAC 1 cut(s) 342
XmnI GAANNNNTTC 1 cut(s) 352
XspI CTAG 2 cut(s) 269, 390
Zsp2I ATGCAT 1 cut(s) 482
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.