MD11G1214300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
31284278 .. 31284939
662 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1214300.v1.1.491

Sequence Viewer

Length: 339 bp
ATGCATTTTAATTGCTTCATTAAGTTTCTTCATACTGTTTTCTTGCAGGGCCTCGTTTTGGCAGTTATCCGCAACGCTGATAAAATGAATTTTGCTGAGATAGATAAGGAGATCAATGATGAGTTGATTTTATATTATATATTTAATTCTATTCTTGATATATTTTGGTTATTATTTTGGAAGAATTTTGATACTTTGAATTGTATTTTCAATATAGGACTTTTGGCTTCCTCTGGAACAAAATGTTATCAAATGGATGAATTTTGGAGTAATTCCAGTTGGAGAAGTTCTTGGAACAAAAGACTATGTTTTAGGGATTATGCGATGGCTTTAGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

13.37

Weight (kDa)

6.04

Isoelectric Point (pI)

44.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 70
AcsI RAATTY 3 cut(s) 88, 184, 260
AfiI CCNNNNNNNGG 1 cut(s) 58
AgsI TTSAA 2 cut(s) 199, 211
AoxI GGCC 1 cut(s) 49
ApoI RAATTY 3 cut(s) 88, 184, 260
AspS9I GGNCC 1 cut(s) 49
BccI CCATC 1 cut(s) 319
BmgT120I GGNCC 1 cut(s) 49
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 276
BseGI GGATG 1 cut(s) 262
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMII CTCAG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 276
BshFI GGCC 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 58
BsnI GGCC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 51
BspCNI CTCAG 1 cut(s) 88
BsrI ACTGG 1 cut(s) 276
BssMI GATC 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 262
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BsuRI GGCC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 49
CviJI RGCY 3 cut(s) 51, 227, 329
CviKI_1 RGCY 3 cut(s) 51, 227, 329
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 49
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 8 cut(s) 33, 133, 138, 140, 161, 215, 307, 321
FokI GGATG 1 cut(s) 269
HaeIII GGCC 1 cut(s) 51
Hpy188III TCNNGA 2 cut(s) 155, 234
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4V TGCA 2 cut(s) 4, 46
HpyF3I CTNAG 1 cut(s) 96
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 3 cut(s) 32, 219, 289
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 2 cut(s) 20, 193
MluCI AATT 7 cut(s) 10, 88, 145, 184, 199, 260, 271
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 2 cut(s) 62, 241
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 3 cut(s) 9, 21, 144
NdeII GATC 1 cut(s) 111
NsiI ATGCAT 1 cut(s) 6
PspPI GGNCC 1 cut(s) 49
SaqAI TTAA 3 cut(s) 9, 21, 144
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 49
SgeI CNNG 7 cut(s) 55, 59, 65, 167, 246, 288, 303
Sse9I AATT 7 cut(s) 10, 88, 145, 184, 199, 260, 271
SsiI CCGC 1 cut(s) 70
TaaI ACNGT 1 cut(s) 37
TasI AATT 7 cut(s) 10, 88, 145, 184, 199, 260, 271
Tru1I TTAA 3 cut(s) 9, 21, 144
Tru9I TTAA 3 cut(s) 9, 21, 144
TspDTI ATGAA 4 cut(s) 7, 20, 101, 273
XapI RAATTY 3 cut(s) 88, 184, 260
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.