pycom05g01800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0018514
Physical Location & Seq
Forward (+)
2169880 .. 2170205
326 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g01800.1

Sequence Viewer

Length: 270 bp
ATGCCTAGGTTGAGCAAGCCAGACCACGAGAATAGCATCAGCAAGAGCTGCATCCCAGGACCAGGACCCTCCTACACTGGTCCAACCTATTTATATTATATATTTAATCCTATTCTTAGTATATTTTGGTTAATATTTTGGAAGAATTTTGATACTTTGAATTGTATTTCCAATATAGAACTTTTGAATTCCTCTAGAGCAAAATGTGGTCAAATGGACGAATTTTGGAGTAATTCCAGTTGGAAGACATTCGTGAGTCACTTGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.25

Weight (kDa)

7.72

Isoelectric Point (pI)

35.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 145, 187, 221
AfiI CCNNNNNNNGG 1 cut(s) 62
AgsI TTSAA 2 cut(s) 160, 187
AjnI CCWGG 2 cut(s) 55, 61
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
ApeKI GCWGC 1 cut(s) 48
ApoI RAATTY 3 cut(s) 145, 187, 221
Asp700I GAANNNNTTC 1 cut(s) 248
AspA2I CCTAGG 1 cut(s) 5
AspS9I GGNCC 3 cut(s) 59, 65, 80
AvaII GGWCC 3 cut(s) 59, 65, 80
AvrII CCTAGG 1 cut(s) 5
BauI CACGAG 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 251
BbvI GCAGC 1 cut(s) 35
BciT130I CCWGG 2 cut(s) 57, 63
BfaI CTAG 2 cut(s) 6, 195
BisI GCNGC 1 cut(s) 49
BlnI CCTAGG 1 cut(s) 5
BlsI GCNGC 1 cut(s) 50
Bme1390I CCNGG 2 cut(s) 57, 63
Bme18I GGWCC 3 cut(s) 59, 65, 80
BmgT120I GGNCC 3 cut(s) 59, 65, 80
BmiI GGNNCC 1 cut(s) 67
BmrFI CCNGG 2 cut(s) 57, 63
BmsI GCATC 2 cut(s) 45, 60
BpiI GAAGAC 1 cut(s) 251
BsaJI CCNNGG 2 cut(s) 5, 55
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse1I ACTGG 2 cut(s) 82, 237
BseBI CCWGG 2 cut(s) 57, 63
BseDI CCNNGG 2 cut(s) 5, 55
BseGI GGATG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 62
BseNI ACTGG 2 cut(s) 82, 237
BseXI GCAGC 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 67
BsrI ACTGG 2 cut(s) 82, 237
BssECI CCNNGG 2 cut(s) 5, 55
BssSI CACGAG 1 cut(s) 26
BssT1I CCWWGG 1 cut(s) 5
Bst2BI CACGAG 1 cut(s) 26
Bst2UI CCWGG 2 cut(s) 57, 63
BstAPI GCANNNNNTGC 1 cut(s) 48
BstC8I GCNNGC 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstNI CCWGG 2 cut(s) 57, 63
BstSCI CCNGG 2 cut(s) 55, 61
BstV1I GCAGC 1 cut(s) 35
BstV2I GAAGAC 1 cut(s) 251
BtsCI GGATG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 17
Cfr13I GGNCC 3 cut(s) 59, 65, 80
CviJI RGCY 3 cut(s) 19, 48, 266
CviKI_1 RGCY 3 cut(s) 19, 48, 266
DdeI CTNAG 1 cut(s) 116
Eco130I CCWWGG 1 cut(s) 5
Eco47I GGWCC 3 cut(s) 59, 65, 80
EcoO109I RGGNCCY 1 cut(s) 65
EcoRI GAATTC 1 cut(s) 187
EcoRII CCWGG 2 cut(s) 55, 61
EcoT14I CCWWGG 1 cut(s) 5
ErhI CCWWGG 1 cut(s) 5
FaiI YATR 5 cut(s) 94, 99, 101, 122, 176
Fnu4HI GCNGC 1 cut(s) 49
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 49
FspBI CTAG 2 cut(s) 6, 195
GluI GCNGC 1 cut(s) 49
HinfI GANTC 1 cut(s) 256
Hpy188III TCNNGA 2 cut(s) 195, 253
HpyCH4V TGCA 1 cut(s) 51
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 116
LpnPI CCDG 7 cut(s) 33, 42, 48, 63, 69, 75, 250
Lsp1109I GCAGC 1 cut(s) 35
LweI GCATC 2 cut(s) 45, 60
MaeI CTAG 2 cut(s) 6, 195
MaeIII GTNAC 1 cut(s) 257
MboII GAAGA 2 cut(s) 154, 256
MluCI AATT 5 cut(s) 145, 160, 187, 221, 232
MlyI GAGTC 1 cut(s) 265
MmeI TCCRAC 2 cut(s) 107, 221
MnlI CCTC 2 cut(s) 79, 202
MroXI GAANNNNTTC 1 cut(s) 248
MseI TTAA 2 cut(s) 105, 131
MspR9I CCNGG 2 cut(s) 57, 63
MvaI CCWGG 2 cut(s) 57, 63
MwoI GCNNNNNNNGC 1 cut(s) 48
NlaIV GGNNCC 1 cut(s) 67
NmuCI GTSAC 1 cut(s) 257
PdmI GAANNNNTTC 1 cut(s) 248
PkrI GCNGC 1 cut(s) 50
PleI GAGTC 1 cut(s) 264
PpsI GAGTC 1 cut(s) 264
PpuMI RGGWCCY 1 cut(s) 65
Psp5II RGGWCCY 1 cut(s) 65
Psp6I CCWGG 2 cut(s) 55, 61
PspGI CCWGG 2 cut(s) 55, 61
PspN4I GGNNCC 1 cut(s) 67
PspPI GGNCC 3 cut(s) 59, 65, 80
PspPPI RGGWCCY 1 cut(s) 65
SaqAI TTAA 2 cut(s) 105, 131
SatI GCNGC 1 cut(s) 49
Sau96I GGNCC 3 cut(s) 59, 65, 80
SchI GAGTC 1 cut(s) 265
ScrFI CCNGG 2 cut(s) 57, 63
SetI ASST 3 cut(s) 11, 50, 89
SfaNI GCATC 2 cut(s) 45, 60
SinI GGWCC 3 cut(s) 59, 65, 80
Sse9I AATT 5 cut(s) 145, 160, 187, 221, 232
SspI AATATT 1 cut(s) 135
SspMI CTAG 2 cut(s) 6, 195
StyD4I CCNGG 2 cut(s) 55, 61
StyI CCWWGG 1 cut(s) 5
TasI AATT 5 cut(s) 145, 160, 187, 221, 232
Tru1I TTAA 2 cut(s) 105, 131
Tru9I TTAA 2 cut(s) 105, 131
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 257
TseI GCWGC 1 cut(s) 48
Tsp45I GTSAC 1 cut(s) 257
TspRI CASTG 1 cut(s) 82
VpaK11BI GGWCC 3 cut(s) 59, 65, 80
XapI RAATTY 3 cut(s) 145, 187, 221
XbaI TCTAGA 1 cut(s) 194
XmaJI CCTAGG 1 cut(s) 5
XmnI GAANNNNTTC 1 cut(s) 248
XspI CTAG 2 cut(s) 6, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.