MD12G1025300.v1.1

Replication protein A 14 kDa subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
2698484 .. 2700560
2077 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1025300.v1.1.491

Sequence Viewer

Length: 333 bp
ATGCCTCCCCGTCGTCGAGATATGAATCCTGCAGTTTTTGTCAATGCAGAGTTGTTGCGATCGTATGTTGGAAGTCGGGTTCGGGCACTGATTCAGGTGGTGCGAGTTGAGGGTGAAACTATCATTGGAAATTCTACTGATGAAAGCCAGCTAGTTGTGAAGGGCATCCCAACGTTTCCTCTTACAAAATTTGTTGAGGTCATAGGCCTTGCTGACAGTGATACGTCCATCCAGGCTGACATGTGGACCAACCTCGGAGAGACAGCTGATACATACACTTACAATCAGCTCTGTCAGATTGTAAATGGGGAATATAAAATCTTGTTCGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.3

Weight (kDa)

4.82

Isoelectric Point (pI)

25.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rep_fac-A_3 PF08661 10 - 106 3.6e-21 Replication factor A protein 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013004)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G52630 AT3G52630 AT4G18590
fragaria_vesca FvH4_6g18910
malus_domestica MD12G1025300.v1.1 MD14G1024000.v1.1
prunus_persica Prupe.7G108800_v2.0.a1
pyrus_communis pycom12g02480
rosa_chinensis RchiOBHm_Chr3g0473901
rosa_laevigata RLG00000023972
rosa_multiflora Rmu_sc0002414.1_g000040
rosa_roxburghii Rroxscaffold_6G00407670
rosa_rugosa Rorug03G0136800
rosa_samantha Rh3AG187000 Rh3BG215600 Rh3CG212300 Rh3DG211500
rosa_wichuraiana Rw3G017120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 173
AcsI RAATTY 2 cut(s) 130, 188
AflIII ACRYGT 1 cut(s) 240
AjnI CCWGG 1 cut(s) 231
AjuI GAANNNNNNNTTGG 2 cut(s) 108, 140
AloI GAACNNNNNNTCC 2 cut(s) 63, 95
AluBI AGCT 3 cut(s) 151, 266, 289
AluI AGCT 3 cut(s) 151, 266, 289
Alw26I GTCTC 1 cut(s) 254
AoxI GGCC 1 cut(s) 205
ApoI RAATTY 2 cut(s) 130, 188
AspS9I GGNCC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 125
AvaII GGWCC 1 cut(s) 246
BaeGI GKGCMC 1 cut(s) 88
BccI CCATC 1 cut(s) 236
BciT130I CCWGG 1 cut(s) 233
BcoDI GTCTC 1 cut(s) 254
BfaI CTAG 1 cut(s) 152
BfmI CTRYAG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 233
Bme18I GGWCC 1 cut(s) 246
BmgT120I GGNCC 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 233
BmsI GCATC 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 253
Bse8I GATNNNNATC 1 cut(s) 24
BseBI CCWGG 1 cut(s) 233
BseDI CCNNGG 1 cut(s) 253
BseGI GGATG 2 cut(s) 165, 228
BseJI GATNNNNATC 1 cut(s) 24
BseSI GKGCMC 1 cut(s) 88
Bsh1285I CGRYCG 1 cut(s) 62
BshFI GGCC 1 cut(s) 207
BsiEI CGRYCG 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 254
BsnI GGCC 1 cut(s) 207
Bsp1286I GDGCHC 1 cut(s) 88
Bsp143I GATC 1 cut(s) 59
BspANI GGCC 1 cut(s) 207
BspMAI CTGCAG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 253
BssMI GATC 1 cut(s) 59
Bst2UI CCWGG 1 cut(s) 233
Bst4CI ACNGT 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 149
BstF5I GGATG 2 cut(s) 165, 228
BstKTI GATC 1 cut(s) 62
BstMAI GTCTC 1 cut(s) 254
BstMBI GATC 1 cut(s) 59
BstMCI CGRYCG 1 cut(s) 62
BstNI CCWGG 1 cut(s) 233
BstNSI RCATGY 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 231
BstSFI CTRYAG 1 cut(s) 30
BstSLI GKGCMC 1 cut(s) 88
BsuRI GGCC 1 cut(s) 207
BtsCI GGATG 2 cut(s) 165, 228
BtsIMutI CAGTG 2 cut(s) 86, 223
Cac8I GCNNGC 1 cut(s) 149
Cfr13I GGNCC 1 cut(s) 246
CviAII CATG 1 cut(s) 241
CviJI RGCY 6 cut(s) 147, 151, 207, 236, 266, 289
CviKI_1 RGCY 6 cut(s) 147, 151, 207, 236, 266, 289
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
Eco147I AGGCCT 1 cut(s) 207
Eco47I GGWCC 1 cut(s) 246
EcoRII CCWGG 1 cut(s) 231
FaeI CATG 1 cut(s) 244
FaiI YATR 6 cut(s) 23, 66, 203, 242, 274, 315
FatI CATG 1 cut(s) 240
FokI GGATG 2 cut(s) 152, 215
FspBI CTAG 1 cut(s) 152
HaeIII GGCC 1 cut(s) 207
Hin1II CATG 1 cut(s) 244
HinfI GANTC 2 cut(s) 25, 91
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 3 cut(s) 257, 297, 332
Hpy188III TCNNGA 1 cut(s) 17
Hpy8I GTNNAC 1 cut(s) 246
Hpy99I CGWCG 2 cut(s) 15, 18
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4IV ACGT 2 cut(s) 173, 224
HpyCH4V TGCA 2 cut(s) 32, 47
HpySE526I ACGT 2 cut(s) 173, 224
Hsp92II CATG 1 cut(s) 244
Kzo9I GATC 1 cut(s) 59
LpnPI CCDG 5 cut(s) 42, 80, 161, 218, 245
LweI GCATC 1 cut(s) 174
MaeI CTAG 1 cut(s) 152
MaeII ACGT 2 cut(s) 173, 224
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MhlI GDGCHC 1 cut(s) 88
MluCI AATT 2 cut(s) 130, 188
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 5 cut(s) 15, 103, 189, 190, 263
MspA1I CMGCKG 1 cut(s) 266
MspR9I CCNGG 1 cut(s) 233
MvaI CCWGG 1 cut(s) 233
NdeII GATC 1 cut(s) 59
NlaIII CATG 1 cut(s) 244
NspI RCATGY 1 cut(s) 244
PceI AGGCCT 1 cut(s) 207
PciI ACATGT 1 cut(s) 240
PfeI GAWTC 2 cut(s) 25, 91
Ple19I CGATCG 1 cut(s) 62
PscI ACATGT 1 cut(s) 240
Psp1406I AACGTT 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 231
PspGI CCWGG 1 cut(s) 231
PspPI GGNCC 1 cut(s) 246
PstI CTGCAG 1 cut(s) 34
PvuI CGATCG 1 cut(s) 62
PvuII CAGCTG 1 cut(s) 266
Sau3AI GATC 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 246
ScrFI CCNGG 1 cut(s) 233
SduI GDGCHC 1 cut(s) 88
SetI ASST 8 cut(s) 99, 153, 176, 201, 227, 255, 268, 291
SfaNI GCATC 1 cut(s) 174
SfcI CTRYAG 1 cut(s) 30
SinI GGWCC 1 cut(s) 246
Sse9I AATT 2 cut(s) 130, 188
SseBI AGGCCT 1 cut(s) 207
SspMI CTAG 1 cut(s) 152
StuI AGGCCT 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 218
TaiI ACGT 2 cut(s) 176, 227
TaqI TCGA 1 cut(s) 16
TasI AATT 2 cut(s) 130, 188
TfiI GAWTC 2 cut(s) 25, 91
TscAI CASTG 2 cut(s) 93, 223
TspDTI ATGAA 2 cut(s) 38, 156
TspRI CASTG 2 cut(s) 93, 223
VpaK11BI GGWCC 1 cut(s) 246
XapI RAATTY 2 cut(s) 130, 188
XceI RCATGY 1 cut(s) 244
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.