MD15G1189700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0019760
Physical Location & Seq
Forward (+)
14955229 .. 14955982
754 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1189700.v1.1.491

Sequence Viewer

Length: 234 bp
ATGCCAGAGAATGGAATTGGGTTTTCCCATATAGCGGCAAAGAGTCCAGGGGGAGGATCTCATGCTGTTTTTCAAGCGTTGACATACTATAGTACGCACTACAATCAGAAGGTATATAAATCTAGATATTTTTACTCTAGTATTTCATTACTAAGGAGAAACCGTTTAGATTATAATTATATAAGGAGAATGGCCTATACAATTTCTCTGTTAGCTTCATGCATCAATTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.82

Weight (kDa)

9.87

Isoelectric Point (pI)

65.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019760)

Species Orthologous Gene IDs
malus_domestica MD02G1051100.v1.1 MD02G1054100.v1.1 MD02G1054200.v1.1 MD02G1055400.v1.1 MD02G1055800.v1.1 MD15G1189700.v1.1
pyrus_communis pycom02g04390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 174
AccB7I CCANNNNNTGG 1 cut(s) 11
AciI CCGC 1 cut(s) 35
AclWI GGATC 1 cut(s) 64
AfaI GTAC 1 cut(s) 94
AfiI CCNNNNNNNGG 3 cut(s) 11, 34, 53
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 1 cut(s) 64
AoxI GGCC 1 cut(s) 192
BciT130I CCWGG 1 cut(s) 48
BfaI CTAG 2 cut(s) 123, 138
BfmI CTRYAG 1 cut(s) 88
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 47
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
Bsc4I CCNNNNNNNGG 3 cut(s) 11, 34, 53
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 47
BseLI CCNNNNNNNGG 3 cut(s) 11, 34, 53
BshFI GGCC 1 cut(s) 194
BslI CCNNNNNNNGG 3 cut(s) 11, 34, 53
BsnI GGCC 1 cut(s) 194
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 1 cut(s) 35
BspANI GGCC 1 cut(s) 194
BspPI GGATC 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 47
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 164
BstDEI CTNAG 2 cut(s) 152, 231
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 88
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BsuRI GGCC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 93
CviAII CATG 2 cut(s) 62, 219
CviJI RGCY 2 cut(s) 194, 215
CviKI_1 RGCY 2 cut(s) 194, 215
CviQI GTAC 1 cut(s) 93
DdeI CTNAG 2 cut(s) 152, 231
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 224
FaeI CATG 2 cut(s) 65, 222
FatI CATG 2 cut(s) 61, 218
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 2 cut(s) 123, 138
GluI GCNGC 1 cut(s) 36
HaeIII GGCC 1 cut(s) 194
Hin1II CATG 2 cut(s) 65, 222
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 123
Hpy8I GTNNAC 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 222
HpyF3I CTNAG 2 cut(s) 152, 231
Hsp92II CATG 2 cut(s) 65, 222
Kzo9I GATC 1 cut(s) 56
LpnPI CCDG 3 cut(s) 18, 33, 60
MaeI CTAG 2 cut(s) 123, 138
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MflI RGATCY 1 cut(s) 56
MluCI AATT 4 cut(s) 15, 175, 201, 226
MlyI GAGTC 1 cut(s) 52
MnlI CCTC 1 cut(s) 47
Mph1103I ATGCAT 1 cut(s) 224
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 56
NlaIII CATG 2 cut(s) 65, 222
NsiI ATGCAT 1 cut(s) 224
PflMI CCANNNNNTGG 1 cut(s) 11
PkrI GCNGC 1 cut(s) 37
PleI GAGTC 1 cut(s) 51
PpsI GAGTC 1 cut(s) 51
PsiI TTATAA 1 cut(s) 174
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 1 cut(s) 56
SchI GAGTC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 48
SetI ASST 2 cut(s) 114, 217
SfcI CTRYAG 1 cut(s) 88
SgeI CNNG 7 cut(s) 17, 59, 60, 74, 86, 135, 150
Sse9I AATT 4 cut(s) 15, 175, 201, 226
SsiI CCGC 1 cut(s) 35
SspMI CTAG 2 cut(s) 123, 138
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 164
TasI AATT 4 cut(s) 15, 175, 201, 226
TauI GCSGC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 135, 207
Van91I CCANNNNNTGG 1 cut(s) 11
XbaI TCTAGA 1 cut(s) 122
XspI CTAG 2 cut(s) 123, 138
Zsp2I ATGCAT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.