MD15G1413600.v1.1
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
51311984 .. 51312404
421 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1413600.v1.1.491

Sequence Viewer

Length: 198 bp
ATGGAATGCAGGGATCTTTCAAATAACAATCTGACAGGGGATATTCCAGTCAATGGATCTTTTTCACTTTTTACTCCCGTCAGTTTTTCCAATAATCCTCGTCTGAATCCACCTCCTCCCGTTTCTCCAACCCCACCAAGTTCTCCAGGTTTTTACAACTTATACTGTTCTTGTGATATTAACTCAAATTTATTTTGA

Protein Analysis

66

Amino Acids

7.06

Weight (kDa)

4.23

Isoelectric Point (pI)

63.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019759)

Species Orthologous Gene IDs
malus_domestica MD15G1413600.v1.1
rosa_laevigata RLG00000008560
rosa_multiflora Rmu_sc0004200.1_g000022
rosa_samantha Rh1CG014000 Rh2DG462300 Rh7AG369600 Rh7CG388100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AclWI GGATC 2 cut(s) 21, 64
AcsI RAATTY 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 21
AjnI CCWGG 1 cut(s) 145
AlwI GGATC 2 cut(s) 21, 64
ApoI RAATTY 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 147
BmrFI CCNGG 1 cut(s) 147
BpmI CTGGAG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 53
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 53
BsmI GAATGC 1 cut(s) 11
Bsp143I GATC 2 cut(s) 13, 56
BspPI GGATC 2 cut(s) 21, 64
BsrI ACTGG 1 cut(s) 47
BssMI GATC 2 cut(s) 13, 56
Bst2UI CCWGG 1 cut(s) 147
Bst4CI ACNGT 1 cut(s) 167
BstKTI GATC 2 cut(s) 16, 59
BstMBI GATC 2 cut(s) 13, 56
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 145
BstX2I RGATCY 2 cut(s) 13, 56
BstYI RGATCY 2 cut(s) 13, 56
DpnI GATC 2 cut(s) 15, 58
DpnII GATC 2 cut(s) 13, 56
EcoRII CCWGG 1 cut(s) 145
FaiI YATR 1 cut(s) 163
GsuI CTGGAG 1 cut(s) 129
HinfI GANTC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 33, 105
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 9
Kzo9I GATC 2 cut(s) 13, 56
LpnPI CCDG 4 cut(s) 21, 60, 132, 159
MalI GATC 2 cut(s) 15, 58
MboI GATC 2 cut(s) 13, 56
MflI RGATCY 2 cut(s) 13, 56
MluCI AATT 1 cut(s) 187
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 3 cut(s) 108, 123, 126
MseI TTAA 1 cut(s) 180
MspR9I CCNGG 1 cut(s) 147
Mva1269I GAATGC 1 cut(s) 11
MvaI CCWGG 1 cut(s) 147
NdeII GATC 2 cut(s) 13, 56
PctI GAATGC 1 cut(s) 11
PfeI GAWTC 1 cut(s) 106
PflMI CCANNNNNTGG 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
PsuI RGATCY 2 cut(s) 13, 56
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 2 cut(s) 13, 56
ScrFI CCNGG 1 cut(s) 147
SetI ASST 2 cut(s) 115, 151
Sse9I AATT 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 145
TaaI ACNGT 1 cut(s) 167
TasI AATT 1 cut(s) 187
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
Van91I CCANNNNNTGG 1 cut(s) 53
XapI RAATTY 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.