Rh2DG462300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
66753200 .. 66756262
3063 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG462300.1

Sequence Viewer

Length: 195 bp
ATGGAGCTTGACAAGGAACTTTATAGTAATAACATAAATGGTAATATTCCAGACGAGCTTGGCAATTTGAACAACCTGAAGCTTGAAGAGGAGTTTCACCAACTAAGTGGGGTGTGGTTGCAAAGTTGCAATGCCTTAACCATAATATTATGGCATATTAATAATTCAAGTGAGATGAGTGGGTGTGGGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.22

Weight (kDa)

4.29

Isoelectric Point (pI)

70.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019759)

Species Orthologous Gene IDs
malus_domestica MD15G1413600.v1.1
rosa_laevigata RLG00000008560
rosa_multiflora Rmu_sc0004200.1_g000022
rosa_samantha Rh1CG014000 Rh2DG462300 Rh7AG369600 Rh7CG388100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 98
AgsI TTSAA 3 cut(s) 70, 86, 168
AluBI AGCT 3 cut(s) 7, 58, 82
AluI AGCT 3 cut(s) 7, 58, 82
AseI ATTAAT 1 cut(s) 159
AsuHPI GGTGA 1 cut(s) 89
Bse3DI GCAATG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 136
BseRI GAGGAG 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 136
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 104
BstXI CCANNNNNNTGG 1 cut(s) 107
CviJI RGCY 3 cut(s) 7, 58, 82
CviKI_1 RGCY 3 cut(s) 7, 58, 82
DdeI CTNAG 1 cut(s) 104
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 98
FaiI YATR 5 cut(s) 24, 35, 143, 151, 156
HindIII AAGCTT 1 cut(s) 80
HphI GGTGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 50
HpyCH4V TGCA 2 cut(s) 121, 129
HpyF3I CTNAG 1 cut(s) 104
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 63, 89
MboII GAAGA 1 cut(s) 98
MluCI AATT 2 cut(s) 64, 163
MnlI CCTC 1 cut(s) 82
MseI TTAA 2 cut(s) 137, 159
PshBI ATTAAT 1 cut(s) 159
SaqAI TTAA 2 cut(s) 137, 159
SetI ASST 4 cut(s) 9, 60, 78, 84
SgeI CNNG 8 cut(s) 20, 25, 62, 67, 71, 88, 95, 180
Sse9I AATT 2 cut(s) 64, 163
SspI AATATT 2 cut(s) 46, 147
TasI AATT 2 cut(s) 64, 163
Tru1I TTAA 2 cut(s) 137, 159
Tru9I TTAA 2 cut(s) 137, 159
VspI ATTAAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.