Rh1CG014000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
2185858 .. 2187859
2002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG014000.1

Sequence Viewer

Length: 294 bp
ATGGAGCGGTTCAGTAAGAGGCTTCAATTTTGTGCTCAACGTGGTCGCTTGGTGTTGGTTGTTGTCGTCGCTTCTATGGAGAAGCTCTCTCTAATCCTTTCCAGGCCAATGGTGTTTGAGTTTTCGAAAGAACTAGACCGAGAAAGAGTTTGTGGGGAACTTTATAGTAATAACATAAATGGTAATATTCCAGACGAGCTTGGCAGTTTGAACAACCTGAAGCTTAAAGAGGAGTTTCACCAGCTAGGTGGGGTGTGGTTGCAAAGTTGCAATGCCTTAACCATTCTATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.1

Weight (kDa)

7.72

Isoelectric Point (pI)

39.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019759)

Species Orthologous Gene IDs
malus_domestica MD15G1413600.v1.1
rosa_laevigata RLG00000008560
rosa_multiflora Rmu_sc0004200.1_g000022
rosa_samantha Rh1CG014000 Rh2DG462300 Rh7AG369600 Rh7CG388100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 7
AciI CCGC 1 cut(s) 7
AcuI CTGAAG 1 cut(s) 239
AgsI TTSAA 2 cut(s) 26, 211
AjnI CCWGG 1 cut(s) 101
AluBI AGCT 4 cut(s) 85, 199, 223, 244
AluI AGCT 4 cut(s) 85, 199, 223, 244
Alw21I GWGCWC 1 cut(s) 37
AoxI GGCC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 230
AsuII TTCGAA 1 cut(s) 125
Bbv12I GWGCWC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 103
BfaI CTAG 2 cut(s) 134, 245
Bme1390I CCNGG 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 103
BplI GAGNNNNNCTC 2 cut(s) 71, 103
Bpu14I TTCGAA 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 277
BseBI CCWGG 1 cut(s) 103
BseMI GCAATG 1 cut(s) 277
BseRI GAGGAG 1 cut(s) 245
BshFI GGCC 1 cut(s) 106
BsiHKAI GWGCWC 1 cut(s) 37
BsnI GGCC 1 cut(s) 106
Bsp119I TTCGAA 1 cut(s) 125
Bsp1286I GDGCHC 1 cut(s) 37
BspACI CCGC 1 cut(s) 7
BspANI GGCC 1 cut(s) 106
BspT104I TTCGAA 1 cut(s) 125
BsrBI CCGCTC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 277
Bst2UI CCWGG 1 cut(s) 103
BstBI TTCGAA 1 cut(s) 125
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BstXI CCANNNNNNTGG 2 cut(s) 109, 248
BsuRI GGCC 1 cut(s) 106
CviJI RGCY 6 cut(s) 22, 85, 106, 199, 223, 244
CviKI_1 RGCY 6 cut(s) 22, 85, 106, 199, 223, 244
Eco57I CTGAAG 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 101
FaiI YATR 3 cut(s) 77, 165, 176
FspBI CTAG 2 cut(s) 134, 245
HaeIII GGCC 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 221
HphI GGTGA 1 cut(s) 230
Hpy188III TCNNGA 1 cut(s) 191
Hpy99I CGWCG 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 262, 270
HpySE526I ACGT 1 cut(s) 40
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 5 cut(s) 88, 115, 204, 230, 254
MaeI CTAG 2 cut(s) 134, 245
MaeII ACGT 1 cut(s) 40
MbiI CCGCTC 1 cut(s) 7
MhlI GDGCHC 1 cut(s) 37
MluCI AATT 1 cut(s) 26
MnlI CCTC 2 cut(s) 12, 223
MseI TTAA 2 cut(s) 225, 278
MspR9I CCNGG 1 cut(s) 103
MvaI CCWGG 1 cut(s) 103
NspV TTCGAA 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 101
PspGI CCWGG 1 cut(s) 101
SaqAI TTAA 2 cut(s) 225, 278
ScrFI CCNGG 1 cut(s) 103
SduI GDGCHC 1 cut(s) 37
SetI ASST 7 cut(s) 43, 87, 201, 219, 225, 246, 250
SfuI TTCGAA 1 cut(s) 125
Sse9I AATT 1 cut(s) 26
SsiI CCGC 1 cut(s) 7
SspI AATATT 1 cut(s) 187
SspMI CTAG 2 cut(s) 134, 245
StyD4I CCNGG 1 cut(s) 101
TaiI ACGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 125
TaqII GACCGA 1 cut(s) 153
TasI AATT 1 cut(s) 26
Tru1I TTAA 2 cut(s) 225, 278
Tru9I TTAA 2 cut(s) 225, 278
XspI CTAG 2 cut(s) 134, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.