MD16G1057300.v1.1

Aldehyde dehydrogenase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0019272
Physical Location & Seq
Forward (+)
4104025 .. 4104590
566 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1057300.v1.1.491

Sequence Viewer

Length: 303 bp
ATGGTCACCAAACCTGCTGAGCAAACACCTCTATCTGCATTATACTGTGTTCATTTGGCTAAGTTGACTGCTGGTGCTGCCATCAGCCATCATATGGACATTGACAAAGCTACAACAAAGAGCAATTTGAAACAAGTTTCACTTGAACTAGGAGGCAAATCACCCCTGGTGATTTTTGATGATGCTGATATAAATATGGCTGCTGATCTTGCTCTCTTGGGAATCCTTTTCAACCAGGTGAAGTTCATAATTTCCGCAGTTAATATGTATAAGTGTATTGGAATGCCAAAAAAAATAAAATAA

Protein Analysis

101

Amino Acids

10.78

Weight (kDa)

8.95

Isoelectric Point (pI)

19.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldedh PF00171 34 - 79 2.1e-09 Aldehyde dehydrogenase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019272)

Species Orthologous Gene IDs
malus_domestica MD02G1206400.v1.1 MD06G1111500.v1.1 MD16G1057300.v1.1
rosa_multiflora Rmu_sc0002995.1_g000006
rosa_roxburghii Rroxscaffold_6G00393520
rosa_samantha Rh3AG283800 Rh3CG318400 Rh3DG317200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 22
AccB7I CCANNNNNTGG 1 cut(s) 94
AciI CCGC 1 cut(s) 255
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 3 cut(s) 130, 146, 232
AjnI CCWGG 2 cut(s) 165, 234
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
ApeKI GCWGC 2 cut(s) 77, 200
AsuHPI GGTGA 3 cut(s) 153, 181, 250
BbvI GCAGC 2 cut(s) 64, 187
BccI CCATC 2 cut(s) 89, 96
BciT130I CCWGG 2 cut(s) 167, 236
BfaI CTAG 1 cut(s) 149
BfuAI ACCTGC 1 cut(s) 22
BisI GCNGC 2 cut(s) 78, 201
BlpI GCTNAGC 1 cut(s) 18
BlsI GCNGC 2 cut(s) 79, 202
Bme1390I CCNGG 2 cut(s) 167, 236
BmrFI CCNGG 2 cut(s) 167, 236
BmsI GCATC 1 cut(s) 172
Bpu1102I GCTNAGC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 2 cut(s) 167, 236
BseDI CCNNGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 9
BseXI GCAGC 2 cut(s) 64, 187
BslI CCNNNNNNNGG 1 cut(s) 94
BsmI GAATGC 1 cut(s) 288
Bsp143I GATC 1 cut(s) 205
Bsp1720I GCTNAGC 1 cut(s) 18
BspACI CCGC 1 cut(s) 255
BspCNI CTCAG 1 cut(s) 10
BspMI ACCTGC 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 1 cut(s) 205
Bst2UI CCWGG 2 cut(s) 167, 236
Bst4CI ACNGT 1 cut(s) 47
BstDEI CTNAG 2 cut(s) 18, 60
BstEII GGTNACC 1 cut(s) 4
BstKTI GATC 1 cut(s) 208
BstMBI GATC 1 cut(s) 205
BstMWI GCNNNNNNNGC 2 cut(s) 77, 209
BstNI CCWGG 2 cut(s) 167, 236
BstPI GGTNACC 1 cut(s) 4
BstSCI CCNGG 2 cut(s) 165, 234
BstV1I GCAGC 2 cut(s) 64, 187
BveI ACCTGC 1 cut(s) 22
CsiI ACCWGGT 1 cut(s) 234
CviJI RGCY 4 cut(s) 59, 87, 110, 200
CviKI_1 RGCY 4 cut(s) 59, 87, 110, 200
DdeI CTNAG 2 cut(s) 18, 60
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
Eco91I GGTNACC 1 cut(s) 4
EcoO65I GGTNACC 1 cut(s) 4
EcoRII CCWGG 2 cut(s) 165, 234
FaiI YATR 8 cut(s) 43, 93, 95, 191, 197, 248, 266, 270
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FauNDI CATATG 1 cut(s) 93
Fnu4HI GCNGC 2 cut(s) 78, 201
Fsp4HI GCNGC 2 cut(s) 78, 201
FspBI CTAG 1 cut(s) 149
GluI GCNGC 2 cut(s) 78, 201
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HinfI GANTC 1 cut(s) 222
HphI GGTGA 3 cut(s) 153, 181, 250
Hpy166II GTNNAC 1 cut(s) 66
Hpy8I GTNNAC 1 cut(s) 66
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 209
HpyF3I CTNAG 2 cut(s) 18, 60
Kzo9I GATC 1 cut(s) 205
LpnPI CCDG 6 cut(s) 27, 57, 152, 179, 221, 248
Lsp1109I GCAGC 2 cut(s) 64, 187
LweI GCATC 1 cut(s) 172
MabI ACCWGGT 1 cut(s) 234
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 4
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MluCI AATT 2 cut(s) 124, 249
MnlI CCTC 2 cut(s) 39, 146
MseI TTAA 1 cut(s) 261
MspR9I CCNGG 2 cut(s) 167, 236
Mva1269I GAATGC 1 cut(s) 288
MvaI CCWGG 2 cut(s) 167, 236
MwoI GCNNNNNNNGC 2 cut(s) 77, 209
NdeI CATATG 1 cut(s) 93
NdeII GATC 1 cut(s) 205
NmuCI GTSAC 1 cut(s) 4
PctI GAATGC 1 cut(s) 288
PfeI GAWTC 1 cut(s) 222
PflMI CCANNNNNTGG 1 cut(s) 94
PkrI GCNGC 2 cut(s) 79, 202
Psp6I CCWGG 2 cut(s) 165, 234
PspEI GGTNACC 1 cut(s) 4
PspGI CCWGG 2 cut(s) 165, 234
SaqAI TTAA 1 cut(s) 261
SatI GCNGC 2 cut(s) 78, 201
Sau3AI GATC 1 cut(s) 205
ScrFI CCNGG 2 cut(s) 167, 236
SetI ASST 4 cut(s) 16, 31, 112, 240
SexAI ACCWGGT 1 cut(s) 234
SfaNI GCATC 1 cut(s) 172
Sse9I AATT 2 cut(s) 124, 249
SsiI CCGC 1 cut(s) 255
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 2 cut(s) 165, 234
TaaI ACNGT 1 cut(s) 47
TasI AATT 2 cut(s) 124, 249
TfiI GAWTC 1 cut(s) 222
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TseFI GTSAC 1 cut(s) 4
TseI GCWGC 2 cut(s) 77, 200
Tsp45I GTSAC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 41, 235
Van91I CCANNNNNTGG 1 cut(s) 94
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.