MD16G1115700.v1.1

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Reverse (-)
8235360 .. 8235635
276 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1115700.v1.1.491

Sequence Viewer

Length: 276 bp
ATGCTGGAGAGGTTTTTGGATTCGGAAATTGATGTTTTAGGGAAAAACTTTGAGCTTCTTCCGTTTGGTGGTGGGAGGAGAATATGTCCTGGATTGCCATTGGCAATGAGAATGTTGAATTTGATGTTGGGCTCGCTTATTAAATCGTTTGACGATTGGACGCTTGAAAATGGAATTGTACCAGAGACCTTGAATATGGAAGAGAAGTTTGGCATCACCTTAGAGAAAGCTCACCCTCTCATAGCTGGGCCCATGCTATATAAAAACCTAGCATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.21

Weight (kDa)

5.02

Isoelectric Point (pI)

30.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 2 - 61 4e-13 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018896)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 118
AfaI GTAC 1 cut(s) 180
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 3 cut(s) 118, 167, 193
AjnI CCWGG 1 cut(s) 88
AjuI GAANNNNNNNTTGG 4 cut(s) 110, 142, 192, 224
AluBI AGCT 3 cut(s) 55, 230, 245
AluI AGCT 3 cut(s) 55, 230, 245
Alw26I GTCTC 1 cut(s) 179
AoxI GGCC 1 cut(s) 248
ApaI GGGCCC 1 cut(s) 252
ApoI RAATTY 1 cut(s) 118
AspS9I GGNCC 2 cut(s) 248, 249
AsuHPI GGTGA 2 cut(s) 208, 224
BaeGI GKGCMC 1 cut(s) 252
BanII GRGCYC 2 cut(s) 134, 252
BciT130I CCWGG 1 cut(s) 90
BcoDI GTCTC 1 cut(s) 179
BfaI CTAG 1 cut(s) 269
Bme1390I CCNGG 1 cut(s) 90
BmgT120I GGNCC 2 cut(s) 248, 249
BmiI GGNNCC 1 cut(s) 250
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 222
BpmI CTGGAG 1 cut(s) 26
BsaI GGTCTC 1 cut(s) 179
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 111
BseRI GAGGAG 1 cut(s) 91
BseSI GKGCMC 1 cut(s) 252
BseYI CCCAGC 1 cut(s) 245
BshFI GGCC 1 cut(s) 250
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 179
BsnI GGCC 1 cut(s) 250
Bso31I GGTCTC 1 cut(s) 179
Bsp120I GGGCCC 1 cut(s) 248
Bsp1286I GDGCHC 2 cut(s) 134, 252
BspANI GGCC 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 250
BspTNI GGTCTC 1 cut(s) 179
BsrDI GCAATG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 90
Bst6I CTCTTC 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 220
BstMAI GTCTC 1 cut(s) 179
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BstSLI GKGCMC 1 cut(s) 252
BsuRI GGCC 1 cut(s) 250
Cac8I GCNNGC 1 cut(s) 134
Cfr13I GGNCC 2 cut(s) 248, 249
CseI GACGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 179
CviAII CATG 2 cut(s) 253, 273
CviJI RGCY 5 cut(s) 55, 132, 230, 245, 250
CviKI_1 RGCY 5 cut(s) 55, 132, 230, 245, 250
CviQI GTAC 1 cut(s) 179
DdeI CTNAG 1 cut(s) 220
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco24I GRGCYC 2 cut(s) 134, 252
Eco31I GGTCTC 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 88
EcoT38I GRGCYC 2 cut(s) 134, 252
FaeI CATG 2 cut(s) 256, 276
FaiI YATR 7 cut(s) 85, 197, 242, 254, 259, 261, 274
FatI CATG 2 cut(s) 252, 272
FriOI GRGCYC 2 cut(s) 134, 252
FspBI CTAG 1 cut(s) 269
GsaI CCCAGC 1 cut(s) 249
GsuI CTGGAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 250
HgaI GACGC 1 cut(s) 169
Hin1II CATG 2 cut(s) 256, 276
HinfI GANTC 1 cut(s) 20
HphI GGTGA 2 cut(s) 208, 224
Hpy188I TCNGA 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 220
Hsp92II CATG 2 cut(s) 256, 276
LpnPI CCDG 4 cut(s) 75, 102, 195, 231
LweI GCATC 1 cut(s) 222
MaeI CTAG 1 cut(s) 269
MboII GAAGA 2 cut(s) 50, 212
MhlI GDGCHC 2 cut(s) 134, 252
MluCI AATT 3 cut(s) 27, 118, 174
MnlI CCTC 3 cut(s) 3, 69, 246
MseI TTAA 1 cut(s) 141
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
NlaIII CATG 2 cut(s) 256, 276
NlaIV GGNNCC 1 cut(s) 250
PfeI GAWTC 1 cut(s) 20
PfoI TCCNGGA 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 88
PspFI CCCAGC 1 cut(s) 245
PspGI CCWGG 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 250
PspOMI GGGCCC 1 cut(s) 248
PspPI GGNCC 2 cut(s) 248, 249
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
SaqAI TTAA 1 cut(s) 141
Sau96I GGNCC 2 cut(s) 248, 249
ScrFI CCNGG 1 cut(s) 90
SduI GDGCHC 2 cut(s) 134, 252
SetI ASST 7 cut(s) 14, 57, 191, 221, 232, 247, 270
SfaNI GCATC 1 cut(s) 222
SgeI CNNG 9 cut(s) 17, 101, 102, 145, 176, 194, 202, 258, 265
Sse9I AATT 3 cut(s) 27, 118, 174
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 1 cut(s) 88
TasI AATT 3 cut(s) 27, 118, 174
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TspGWI ACGGA 1 cut(s) 51
XapI RAATTY 1 cut(s) 118
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.