Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0018896

Physical Location & Seq

Genomic Coordinates Reverse (-)

41578133 .. 41578609

Gene Structure 477 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00360940.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 195 bp

ATGCCGGAGAGGTTCTTAGGATTGGAGAACCAAATTGATGTTATGGGAACAAACTTTGATCTTATTCCATTTGGTGGTGGAAGAAGAATATGTCCTGGACTGCCACCGGCAATGAAAATGTTACACTTGACGTTGGGTTCACTCATTAACTGCTTCAATTGGAAACTTGAAGATGGAGTTGTATCGAGACTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0008150 GO:0008152 GO:0009058 GO:0016020 GO:0016491 GO:0016705 GO:0016709 GO:0019748 GO:0044550 GO:0055114

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

64

Amino Acids

7.13

Weight (kDa)

6.52

Isoelectric Point (pI)

49.27

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
p450	PF00067	1 - 58	1.7e-10	Cytochrome P450

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018896)

Species	Orthologous Gene IDs
malus_domestica	MD12G1099300.v1.1 MD16G1115700.v1.1
rosa_chinensis	RchiOBHm_Chr1g0346031 RchiOBHm_Chr4g0430061 RchiOBHm_Chr7g0218011
rosa_laevigata	RLG00000024131
rosa_roxburghii	Rroxscaffold_5G00360940
rosa_rugosa	Rorug03G0120100 Rorug03G0120400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	74
AfiI	CCNNNNNNNGG	1 cut(s)	74
AgsI	TTSAA	2 cut(s)	157, 170
AjnI	CCWGG	1 cut(s)	94
Alw26I	GTCTC	1 cut(s)	181
BccI	CCATC	1 cut(s)	167
BciT130I	CCWGG	1 cut(s)	96
BcoDI	GTCTC	1 cut(s)	181
Bme1390I	CCNGG	1 cut(s)	96
BmrFI	CCNGG	1 cut(s)	96
Bsc4I	CCNNNNNNNGG	1 cut(s)	74
Bse118I	RCCGGY	1 cut(s)	106
Bse3DI	GCAATG	1 cut(s)	117
BseBI	CCWGG	1 cut(s)	96
BseLI	CCNNNNNNNGG	1 cut(s)	74
BseMI	GCAATG	1 cut(s)	117
BsiSI	CCGG	2 cut(s)	5, 107
BslI	CCNNNNNNNGG	1 cut(s)	74
BsmAI	GTCTC	1 cut(s)	181
Bsp143I	GATC	1 cut(s)	58
BsrDI	GCAATG	1 cut(s)	117
BsrFI	RCCGGY	1 cut(s)	106
BssAI	RCCGGY	1 cut(s)	106
BssMI	GATC	1 cut(s)	58
Bst2UI	CCWGG	1 cut(s)	96
BstDEI	CTNAG	1 cut(s)	16
BstKTI	GATC	1 cut(s)	61
BstMAI	GTCTC	1 cut(s)	181
BstMBI	GATC	1 cut(s)	58
BstNI	CCWGG	1 cut(s)	96
BstSCI	CCNGG	1 cut(s)	94
Cfr10I	RCCGGY	1 cut(s)	106
DdeI	CTNAG	1 cut(s)	16
DpnI	GATC	1 cut(s)	60
DpnII	GATC	1 cut(s)	58
EcoRII	CCWGG	1 cut(s)	94
FaiI	YATR	3 cut(s)	44, 91, 193
HapII	CCGG	2 cut(s)	5, 107
HpaII	CCGG	2 cut(s)	5, 107
Hpy166II	GTNNAC	1 cut(s)	140
Hpy188III	TCNNGA	1 cut(s)	186
Hpy8I	GTNNAC	1 cut(s)	140
HpyCH4IV	ACGT	1 cut(s)	131
HpyF3I	CTNAG	1 cut(s)	16
HpySE526I	ACGT	1 cut(s)	131
Kzo9I	GATC	1 cut(s)	58
LpnPI	CCDG	4 cut(s)	18, 81, 108, 120
MaeII	ACGT	1 cut(s)	131
MaeIII	GTNAC	1 cut(s)	120
MalI	GATC	1 cut(s)	60
MboI	GATC	1 cut(s)	58
MboII	GAAGA	3 cut(s)	93, 96, 182
MfeI	CAATTG	1 cut(s)	157
MluCI	AATT	2 cut(s)	33, 157
MnlI	CCTC	1 cut(s)	3
MseI	TTAA	1 cut(s)	147
MspI	CCGG	2 cut(s)	5, 107
MspR9I	CCNGG	1 cut(s)	96
MunI	CAATTG	1 cut(s)	157
MvaI	CCWGG	1 cut(s)	96
NdeII	GATC	1 cut(s)	58
PflMI	CCANNNNNTGG	1 cut(s)	74
PfoI	TCCNGGA	1 cut(s)	94
Psp6I	CCWGG	1 cut(s)	94
PspGI	CCWGG	1 cut(s)	94
SaqAI	TTAA	1 cut(s)	147
Sau3AI	GATC	1 cut(s)	58
ScrFI	CCNGG	1 cut(s)	96
SetI	ASST	2 cut(s)	14, 134
SgeI	CNNG	6 cut(s)	17, 107, 108, 119, 139, 179
Sse9I	AATT	2 cut(s)	33, 157
StyD4I	CCNGG	1 cut(s)	94
TaiI	ACGT	1 cut(s)	134
TaqI	TCGA	1 cut(s)	185
TasI	AATT	2 cut(s)	33, 157
Tru1I	TTAA	1 cut(s)	147
Tru9I	TTAA	1 cut(s)	147
TspDTI	ATGAA	1 cut(s)	128
Van91I	CCANNNNNTGG	1 cut(s)	74

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.