RchiOBHm_Chr1g0346031

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
38197175 .. 38197405
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57232

Sequence Viewer

Length: 231 bp
ATGTTATGGGGAAAAACTTTGAGCTTATATATTCCGTTTGGTGGTGGAAGGAGAATATGCCCCAAACTTCCATTGGCAGTAAGAATGTTGCACTTGATAAATTCACTAATTAACTGCTTTGATTGGAAGCTTGAAGATGGAGTTGTACCCGAAACTATGAACATGGGAGATAAGTTTGGCCTTACCTTACAAATGGCTCAGCCTCTGAGAGCTATACCCAAGAAGTCATAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.57

Weight (kDa)

9.69

Isoelectric Point (pI)

44.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018896)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 100
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 3 cut(s) 24, 130, 212
AluI AGCT 3 cut(s) 24, 130, 212
AlwNI CAGNNNCTG 1 cut(s) 205
AoxI GGCC 1 cut(s) 178
ApoI RAATTY 1 cut(s) 100
BccI CCATC 1 cut(s) 131
BlpI GCTNAGC 1 cut(s) 198
Bpu1102I GCTNAGC 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 2 cut(s) 197, 212
BshFI GGCC 1 cut(s) 180
BslI CCNNNNNNNGG 1 cut(s) 41
BsnI GGCC 1 cut(s) 180
Bsp1720I GCTNAGC 1 cut(s) 198
BspANI GGCC 1 cut(s) 180
BspCNI CTCAG 2 cut(s) 198, 211
BstDEI CTNAG 2 cut(s) 198, 206
BsuRI GGCC 1 cut(s) 180
CaiI CAGNNNCTG 1 cut(s) 205
Csp6I GTAC 1 cut(s) 146
CviAII CATG 1 cut(s) 163
CviJI RGCY 6 cut(s) 24, 130, 180, 197, 202, 212
CviKI_1 RGCY 6 cut(s) 24, 130, 180, 197, 202, 212
CviQI GTAC 1 cut(s) 146
DdeI CTNAG 2 cut(s) 198, 206
FaeI CATG 1 cut(s) 166
FaiI YATR 8 cut(s) 7, 28, 30, 58, 158, 164, 215, 229
FatI CATG 1 cut(s) 162
HaeIII GGCC 1 cut(s) 180
Hin1II CATG 1 cut(s) 166
HindIII AAGCTT 1 cut(s) 128
Hpy188I TCNGA 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 91
HpyF3I CTNAG 2 cut(s) 198, 206
Hsp92II CATG 1 cut(s) 166
MboII GAAGA 1 cut(s) 146
MluCI AATT 2 cut(s) 100, 108
MnlI CCTC 1 cut(s) 213
MseI TTAA 1 cut(s) 111
NlaIII CATG 1 cut(s) 166
PstNI CAGNNNCTG 1 cut(s) 205
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 111
SetI ASST 4 cut(s) 26, 132, 188, 214
SgeI CNNG 4 cut(s) 106, 143, 161, 175
Sse9I AATT 2 cut(s) 100, 108
TasI AATT 2 cut(s) 100, 108
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 173
TspGWI ACGGA 1 cut(s) 24
XapI RAATTY 1 cut(s) 100
XcmI CCANNNNNNNNNTGG 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.