MD17G1028000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0017740
Physical Location & Seq
Reverse (-)
1995702 .. 1996083
382 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1028000.v1.1.491

Sequence Viewer

Length: 156 bp
ATGCCGCGAGGTACGTCACCAGGTCACAAGATGTCAAGCAGCTTCAAGTCAGCCTTCCCGTCTTCAGGGTGTGTTCCCTCGGGAGCCGAAGAAAAGGGTGAAGGGAAATCACCATACTTATTATCACTTGAAGGATGTTTCTTTCATTCAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.29

Weight (kDa)

7.83

Isoelectric Point (pI)

72.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 7
AciI CCGC 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 65
AgsI TTSAA 2 cut(s) 46, 131
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 1 cut(s) 42
AluI AGCT 1 cut(s) 42
Ama87I CYCGRG 1 cut(s) 79
ApeKI GCWGC 1 cut(s) 39
AsuHPI GGTGA 3 cut(s) 9, 102, 110
AvaI CYCGRG 1 cut(s) 79
BbsI GAAGAC 1 cut(s) 54
BbvI GCAGC 1 cut(s) 51
BciT130I CCWGG 1 cut(s) 21
BisI GCNGC 2 cut(s) 5, 40
BlsI GCNGC 2 cut(s) 6, 41
Bme1390I CCNGG 1 cut(s) 21
BmeT110I CYCGRG 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 78
Bsc4I CCNNNNNNNGG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 65
BseXI GCAGC 1 cut(s) 51
Bsh1236I CGCG 1 cut(s) 7
BsiHKCI CYCGRG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 65
BsoBI CYCGRG 1 cut(s) 79
BspACI CCGC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 140
BstFNI CGCG 1 cut(s) 7
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstUI CGCG 1 cut(s) 7
BstV1I GCAGC 1 cut(s) 51
BstV2I GAAGAC 1 cut(s) 54
BtsCI GGATG 1 cut(s) 140
CsiI ACCWGGT 1 cut(s) 19
Csp6I GTAC 1 cut(s) 12
CviAII CATG 1 cut(s) 153
CviJI RGCY 3 cut(s) 42, 53, 86
CviKI_1 RGCY 3 cut(s) 42, 53, 86
CviQI GTAC 1 cut(s) 12
Eco57I CTGAAG 1 cut(s) 48
Eco88I CYCGRG 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 19
FaeI CATG 1 cut(s) 156
FaiI YATR 2 cut(s) 115, 154
FalI AAGNNNNNCTT 2 cut(s) 38, 70
FatI CATG 1 cut(s) 152
Fnu4HI GCNGC 2 cut(s) 5, 40
FokI GGATG 1 cut(s) 147
Fsp4HI GCNGC 2 cut(s) 5, 40
GluI GCNGC 2 cut(s) 5, 40
Hin1II CATG 1 cut(s) 156
HphI GGTGA 3 cut(s) 9, 102, 110
Hpy188III TCNNGA 1 cut(s) 81
HpyAV CCTTC 3 cut(s) 64, 95, 125
HpyCH4IV ACGT 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 14
Hsp92II CATG 1 cut(s) 156
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 3 cut(s) 6, 33, 51
Lsp1109I GCAGC 1 cut(s) 51
MabI ACCWGGT 1 cut(s) 19
MaeII ACGT 1 cut(s) 14
MaeIII GTNAC 2 cut(s) 15, 23
MboII GAAGA 2 cut(s) 54, 101
MnlI CCTC 1 cut(s) 88
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MvnI CGCG 1 cut(s) 7
NlaIII CATG 1 cut(s) 156
NlaIV GGNNCC 1 cut(s) 85
NmuCI GTSAC 2 cut(s) 15, 23
PkrI GCNGC 2 cut(s) 6, 41
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 85
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SatI GCNGC 2 cut(s) 5, 40
ScrFI CCNGG 1 cut(s) 21
SetI ASST 4 cut(s) 13, 17, 25, 44
SexAI ACCWGGT 1 cut(s) 19
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 19
TaiI ACGT 1 cut(s) 17
TauI GCSGC 1 cut(s) 7
TseFI GTSAC 2 cut(s) 15, 23
TseI GCWGC 1 cut(s) 39
Tsp45I GTSAC 2 cut(s) 15, 23
TspDTI ATGAA 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.