MD17G1041500.v1.1

Gibberellin-regulated protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
3032288 .. 3034001
1714 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1041500.v1.1.491

Sequence Viewer

Length: 327 bp
ATGGCCATGGCTAAGTTCTTTGCTGCCTTGTTCTTGGCTCTCCTTGCCATCTCCATGCTTCAAACCATGGTTTTGGCAAATCATGGGCATGGAGGTCATCACAAGGGCAATAATGCCTATGGACCTGGGAGTCTCAAGAGCAGCCAATGCCCGTCCGAATGCACGAGGAGGTGCAGCCAGACGCAGTACCACAAGCCCTGCATGTTCTTCTGTCAGAAATGCTGCAAAAAGTGCCTGTGTGTGCCCCCTGGGTTTTACGGGAACAAGGCCGTGTGCCCTTGCTACAACAACTGGAAGACCCAGCAAGGAGGACCCAAATGCCCCTGA

Protein Analysis

109

Amino Acids

11.85

Weight (kDa)

9.27

Isoelectric Point (pI)

51.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GASA PF02704 49 - 108 5.1e-23 Gibberellin regulated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016513)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G15230 AT5G15230
fragaria_vesca FvH4_6g48590
malus_domestica MD09G1051300.v1.1 MD17G1041500.v1.1
prunus_persica Prupe.3G267600_v2.0.a1
pyrus_communis pycom111g04250 pycom17g04610
rosa_chinensis RchiOBHm_Chr2g0168411
rosa_laevigata RLG00000021780
rosa_multiflora Rmu_sc0002789.1_g000002 Rmu_sc0012607.1_g000003
rosa_rugosa Rorug02G0533800
rosa_wichuraiana Rw2G050040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 2 cut(s) 124, 247
Alw26I GTCTC 1 cut(s) 137
AoxI GGCC 2 cut(s) 3, 267
ApeKI GCWGC 4 cut(s) 23, 141, 174, 222
AspS9I GGNCC 2 cut(s) 122, 311
AvaII GGWCC 2 cut(s) 122, 311
BaeGI GKGCMC 2 cut(s) 246, 278
BalI TGGCCA 1 cut(s) 5
BauI CACGAG 1 cut(s) 163
BbsI GAAGAC 1 cut(s) 302
BbvI GCAGC 4 cut(s) 10, 153, 186, 209
BccI CCATC 1 cut(s) 56
BceAI ACGGC 1 cut(s) 254
BciT130I CCWGG 2 cut(s) 126, 249
BcoDI GTCTC 1 cut(s) 137
BisI GCNGC 4 cut(s) 24, 142, 175, 223
BlsI GCNGC 4 cut(s) 25, 143, 176, 224
Bme1390I CCNGG 2 cut(s) 126, 249
Bme18I GGWCC 2 cut(s) 122, 311
BmgT120I GGNCC 2 cut(s) 122, 311
BmiI GGNNCC 1 cut(s) 313
BmrFI CCNGG 2 cut(s) 126, 249
BpiI GAAGAC 1 cut(s) 302
BpuEI CTTGAG 1 cut(s) 119
BsaJI CCNNGG 5 cut(s) 6, 66, 125, 247, 248
Bse1I ACTGG 1 cut(s) 296
BseBI CCWGG 2 cut(s) 126, 249
BseDI CCNNGG 5 cut(s) 6, 66, 125, 247, 248
BseNI ACTGG 1 cut(s) 296
BseRI GAGGAG 1 cut(s) 181
BseSI GKGCMC 2 cut(s) 246, 278
BseXI GCAGC 4 cut(s) 10, 153, 186, 209
BseYI CCCAGC 1 cut(s) 300
BsgI GTGCAG 1 cut(s) 193
BshFI GGCC 2 cut(s) 5, 269
BsmAI GTCTC 1 cut(s) 137
BsmI GAATGC 1 cut(s) 164
BsnI GGCC 2 cut(s) 5, 269
Bsp1286I GDGCHC 2 cut(s) 246, 278
Bsp19I CCATGG 2 cut(s) 6, 66
BspANI GGCC 2 cut(s) 5, 269
BspLI GGNNCC 1 cut(s) 313
BsrI ACTGG 1 cut(s) 296
BssECI CCNNGG 5 cut(s) 6, 66, 125, 247, 248
BssSI CACGAG 1 cut(s) 163
BssT1I CCWWGG 2 cut(s) 6, 66
Bst2BI CACGAG 1 cut(s) 163
Bst2UI CCWGG 2 cut(s) 126, 249
BstAPI GCANNNNNTGC 2 cut(s) 147, 231
BstDEI CTNAG 1 cut(s) 12
BstDSI CCRYGG 2 cut(s) 6, 66
BstMAI GTCTC 1 cut(s) 137
BstMWI GCNNNNNNNGC 3 cut(s) 44, 147, 231
BstNI CCWGG 2 cut(s) 126, 249
BstNSI RCATGY 1 cut(s) 205
BstSCI CCNGG 2 cut(s) 124, 247
BstSLI GKGCMC 2 cut(s) 246, 278
BstV1I GCAGC 4 cut(s) 10, 153, 186, 209
BstV2I GAAGAC 1 cut(s) 302
BstXI CCANNNNNNTGG 1 cut(s) 73
BsuRI GGCC 2 cut(s) 5, 269
BtgI CCRYGG 2 cut(s) 6, 66
Cfr13I GGNCC 2 cut(s) 122, 311
CseI GACGC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 187
CviAII CATG 6 cut(s) 7, 55, 67, 83, 89, 202
CviJI RGCY 7 cut(s) 5, 11, 38, 144, 177, 196, 269
CviKI_1 RGCY 7 cut(s) 5, 11, 38, 144, 177, 196, 269
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 1 cut(s) 12
DrdI GACNNNNNNGTC 1 cut(s) 129
DseDI GACNNNNNNGTC 1 cut(s) 129
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 6, 66
Eco47I GGWCC 2 cut(s) 122, 311
EcoO109I RGGNCCY 1 cut(s) 311
EcoRII CCWGG 2 cut(s) 124, 247
EcoT14I CCWWGG 2 cut(s) 6, 66
ErhI CCWWGG 2 cut(s) 6, 66
FaeI CATG 6 cut(s) 10, 58, 70, 86, 92, 205
FaiI YATR 7 cut(s) 8, 56, 68, 84, 90, 120, 203
FatI CATG 6 cut(s) 6, 54, 66, 82, 88, 201
Fnu4HI GCNGC 4 cut(s) 24, 142, 175, 223
Fsp4HI GCNGC 4 cut(s) 24, 142, 175, 223
GluI GCNGC 4 cut(s) 24, 142, 175, 223
GsaI CCCAGC 1 cut(s) 304
HaeIII GGCC 2 cut(s) 5, 269
HgaI GACGC 1 cut(s) 190
Hin1II CATG 6 cut(s) 10, 58, 70, 86, 92, 205
HinfI GANTC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 157, 216
Hpy188III TCNNGA 1 cut(s) 136
HpyCH4V TGCA 4 cut(s) 162, 174, 201, 225
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 147, 231
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 6 cut(s) 10, 58, 70, 86, 92, 205
LpnPI CCDG 9 cut(s) 111, 138, 191, 211, 234, 248, 261, 277, 314
Lsp1109I GCAGC 4 cut(s) 10, 153, 186, 209
MboII GAAGA 2 cut(s) 199, 307
MhlI GDGCHC 2 cut(s) 246, 278
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 139
MnlI CCTC 4 cut(s) 86, 159, 162, 302
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 2 cut(s) 53, 87
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 2 cut(s) 126, 249
Mva1269I GAATGC 1 cut(s) 164
MvaI CCWGG 2 cut(s) 126, 249
MwoI GCNNNNNNNGC 3 cut(s) 44, 147, 231
NcoI CCATGG 2 cut(s) 6, 66
NlaIII CATG 6 cut(s) 10, 58, 70, 86, 92, 205
NlaIV GGNNCC 1 cut(s) 313
NspI RCATGY 1 cut(s) 205
PasI CCCWGGG 1 cut(s) 248
PctI GAATGC 1 cut(s) 164
PkrI GCNGC 4 cut(s) 25, 143, 176, 224
PleI GAGTC 1 cut(s) 138
PpsI GAGTC 1 cut(s) 138
PpuMI RGGWCCY 1 cut(s) 311
Psp5II RGGWCCY 1 cut(s) 311
Psp6I CCWGG 2 cut(s) 124, 247
PspFI CCCAGC 1 cut(s) 300
PspGI CCWGG 2 cut(s) 124, 247
PspN4I GGNNCC 1 cut(s) 313
PspPI GGNCC 2 cut(s) 122, 311
PspPPI RGGWCCY 1 cut(s) 311
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
RseI CAYNNNNRTG 2 cut(s) 53, 87
SatI GCNGC 4 cut(s) 24, 142, 175, 223
Sau96I GGNCC 2 cut(s) 122, 311
SchI GAGTC 1 cut(s) 139
ScrFI CCNGG 2 cut(s) 126, 249
SduI GDGCHC 2 cut(s) 246, 278
SetI ASST 3 cut(s) 97, 127, 173
SinI GGWCC 2 cut(s) 122, 311
SmiMI CAYNNNNRTG 2 cut(s) 53, 87
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
StyD4I CCNGG 2 cut(s) 124, 247
StyI CCWWGG 2 cut(s) 6, 66
TseI GCWGC 4 cut(s) 23, 141, 174, 222
VpaK11BI GGWCC 2 cut(s) 122, 311
XceI RCATGY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.