MD17G1120000.v1.1
RLK Family

cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
10438768 .. 10442091
3324 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1120000.v1.1.491

Sequence Viewer

Length: 381 bp
ATGCGAGAAGGAACTCTCACAGAAAATGAGAGAAAACCTCTCACAGGGAGAGAAAATGAAGTTTTTGTTAAGGTTTCGTGCCTCGCTATAAGGTTGGGTTTGGTATATGTAAAAAGGAATTCACGGCACATTAATTCCTGTGTCTCTTCCCAAGAGTTGAGAAATGACTTGACGACGAAGAAGGTGATTGGTTTGGGTAAGCAACGTGGAGGGCTTTACTACTTGGTAGCTCTCGCCAAGTCTGCAACCTTGTTCTCTCACCCACAGAGTTGTGGCATCGGCGTTTGGGTCATTTATTTCCTTCTAAGCTCGATTTCATGTCAAAACACCTGTTGCATTTTCCTTTTCAATCCAATAATGCTTGTAATGTTTGTCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.15

Weight (kDa)

9.47

Isoelectric Point (pI)

40.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018704)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G03940
malus_domestica MD17G1120000.v1.1
pyrus_communis pycom03g19420 pycom10g09460 pycom10g21720 pycom13g28160 pycom14g05170
rosa_chinensis RchiOBHm_Chr3g0491631
rosa_wichuraiana Rw5G011130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 349
AluBI AGCT 2 cut(s) 230, 309
AluI AGCT 2 cut(s) 230, 309
Alw26I GTCTC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 118
AseI ATTAAT 1 cut(s) 132
AsuHPI GGTGA 2 cut(s) 196, 251
BceAI ACGGC 1 cut(s) 140
BcoDI GTCTC 1 cut(s) 148
BmsI GCATC 1 cut(s) 285
BplI GAGNNNNNCTC 2 cut(s) 22, 54
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 44
BsmAI GTCTC 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 305
BstENI CCTNNNNNAGG 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 242
CviAII CATG 1 cut(s) 318
CviJI RGCY 3 cut(s) 214, 230, 309
CviKI_1 RGCY 3 cut(s) 214, 230, 309
DdeI CTNAG 1 cut(s) 305
Eam1104I CTCTTC 1 cut(s) 151
EarI CTCTTC 1 cut(s) 151
EcoNI CCTNNNNNAGG 1 cut(s) 42
EcoRI GAATTC 1 cut(s) 118
FaeI CATG 1 cut(s) 321
FaiI YATR 4 cut(s) 89, 106, 108, 319
FatI CATG 1 cut(s) 317
Hin1II CATG 1 cut(s) 321
HphI GGTGA 2 cut(s) 196, 251
Hpy99I CGWCG 1 cut(s) 178
HpyAV CCTTC 2 cut(s) 175, 311
HpyCH4IV ACGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 245, 336
HpyF10VI GCNNNNNNNGC 1 cut(s) 242
HpyF3I CTNAG 1 cut(s) 305
HpySE526I ACGT 1 cut(s) 205
Hsp92II CATG 1 cut(s) 321
LpnPI CCDG 3 cut(s) 30, 151, 343
LweI GCATC 1 cut(s) 285
MaeII ACGT 1 cut(s) 205
MboII GAAGA 2 cut(s) 138, 190
MluCI AATT 2 cut(s) 118, 133
MnlI CCTC 3 cut(s) 48, 92, 203
MseI TTAA 2 cut(s) 69, 132
MwoI GCNNNNNNNGC 1 cut(s) 242
NlaIII CATG 1 cut(s) 321
PshBI ATTAAT 1 cut(s) 132
SaqAI TTAA 2 cut(s) 69, 132
SetI ASST 9 cut(s) 40, 75, 95, 186, 208, 232, 251, 311, 332
SfaNI GCATC 1 cut(s) 285
Sse9I AATT 2 cut(s) 118, 133
TaiI ACGT 1 cut(s) 208
TaqI TCGA 1 cut(s) 311
TasI AATT 2 cut(s) 118, 133
Tru1I TTAA 2 cut(s) 69, 132
Tru9I TTAA 2 cut(s) 69, 132
TspDTI ATGAA 2 cut(s) 72, 306
VspI ATTAAT 1 cut(s) 132
XagI CCTNNNNNAGG 1 cut(s) 42
XapI RAATTY 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.