Prupe.1G064700_v2.0.a1

DOMON domain-containing protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
4600146 .. 4602306
2161 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G064700.1

Sequence Viewer

Length: 204 bp
ATGTTAAGAACTCGTTTGCTCTGGTTCGGTCTTGGGTTTTCGTTGACAGGAGCTGCGATTTCTCACCTGGTTTGGAAAGATCTTCTGGTGGACCGCTGCGTTCTTTCCTCTGATGTGAAGCAAAAGTTTGATGCTCTTGAAGGTAGAATCGTGAACCTCGAGCGTTCTTTATCAGAGCCGAATCCCGCTCAGGTTGAGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.57

Weight (kDa)

5.74

Isoelectric Point (pI)

34.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015919)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 188
AciI CCGC 2 cut(s) 94, 186
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwNI CAGNNNCTG 1 cut(s) 53
Ama87I CYCGRG 1 cut(s) 158
ApeKI GCWGC 2 cut(s) 53, 96
AspS9I GGNCC 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 56
AvaI CYCGRG 1 cut(s) 158
AvaII GGWCC 1 cut(s) 91
BbvI GCAGC 2 cut(s) 40, 83
BciT130I CCWGG 1 cut(s) 68
BglII AGATCT 1 cut(s) 79
BisI GCNGC 2 cut(s) 54, 97
BlsI GCNGC 2 cut(s) 55, 98
Bme1390I CCNGG 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 91
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 68
BmsI GCATC 1 cut(s) 121
Bpu10I CCTNAGC 1 cut(s) 189
BseBI CCWGG 1 cut(s) 68
BseMII CTCAG 1 cut(s) 203
BseXI GCAGC 2 cut(s) 40, 83
BsiHKCI CYCGRG 1 cut(s) 158
BsoBI CYCGRG 1 cut(s) 158
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 2 cut(s) 94, 186
BspCNI CTCAG 1 cut(s) 202
BsrBI CCGCTC 1 cut(s) 188
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 189
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 66
BstV1I GCAGC 2 cut(s) 40, 83
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
CaiI CAGNNNCTG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 91
CsiI ACCWGGT 1 cut(s) 66
CviJI RGCY 2 cut(s) 53, 178
CviKI_1 RGCY 2 cut(s) 53, 178
DdeI CTNAG 1 cut(s) 189
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 91
Eco88I CYCGRG 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 66
FauI CCCGC 1 cut(s) 193
Fnu4HI GCNGC 2 cut(s) 54, 97
Fsp4HI GCNGC 2 cut(s) 54, 97
GluI GCNGC 2 cut(s) 54, 97
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HinfI GANTC 2 cut(s) 147, 181
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 3 cut(s) 45, 91, 154
Hpy188I TCNGA 2 cut(s) 112, 175
Hpy188III TCNNGA 2 cut(s) 137, 151
Hpy8I GTNNAC 3 cut(s) 45, 91, 154
HpyAV CCTTC 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 189
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 6 cut(s) 7, 33, 53, 71, 80, 176
Lsp1109I GCAGC 2 cut(s) 40, 83
LweI GCATC 1 cut(s) 121
MabI ACCWGGT 1 cut(s) 66
MalI GATC 1 cut(s) 81
MbiI CCGCTC 1 cut(s) 188
MboI GATC 1 cut(s) 79
MboII GAAGA 1 cut(s) 74
MflI RGATCY 1 cut(s) 79
MnlI CCTC 3 cut(s) 118, 167, 190
MseI TTAA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
NdeII GATC 1 cut(s) 79
PaeR7I CTCGAG 1 cut(s) 158
PcsI WCGNNNNNNNCGW 1 cut(s) 156
PfeI GAWTC 2 cut(s) 147, 181
PkrI GCNGC 2 cut(s) 55, 98
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
PspPI GGNCC 1 cut(s) 91
PspXI VCTCGAGB 1 cut(s) 158
PstNI CAGNNNCTG 1 cut(s) 53
PsuI RGATCY 1 cut(s) 79
SaqAI TTAA 1 cut(s) 5
SatI GCNGC 2 cut(s) 54, 97
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 68
SetI ASST 5 cut(s) 55, 69, 145, 159, 195
SexAI ACCWGGT 1 cut(s) 66
SfaNI GCATC 1 cut(s) 121
Sfr274I CTCGAG 1 cut(s) 158
SinI GGWCC 1 cut(s) 91
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SsiI CCGC 2 cut(s) 94, 186
StyD4I CCNGG 1 cut(s) 66
TaqI TCGA 1 cut(s) 159
TaqII GACCGA 1 cut(s) 17
TfiI GAWTC 2 cut(s) 147, 181
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TseI GCWGC 2 cut(s) 53, 96
VpaK11BI GGWCC 1 cut(s) 91
XhoI CTCGAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.