Rw4G006550

DOMON domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
13622842 .. 13625286
2445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G006550.1

Sequence Viewer

Length: 207 bp
ATGATGAGAGCTCGTTTGCTCTGGTTCGCTCTCGGCTTCTCCTCCACCGGAGCTGCAATATCTCACCTGATTTGGAAAGATCTTATTGTCGACCGCACCGCTCTCTCCTCTGATGTGATGGGAAAGTTTGCTGCTCTTGAAAGCAGAATCGTGAACCTGGAGCATTCGTATCAGAATCCGAATCCGGCTGCTCAGGCCGAGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.53

Weight (kDa)

6.03

Isoelectric Point (pI)

17.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015919)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 101
AccI GTMKAC 1 cut(s) 90
AciI CCGC 2 cut(s) 94, 99
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 1 cut(s) 156
AluBI AGCT 2 cut(s) 11, 53
AluI AGCT 2 cut(s) 11, 53
Alw21I GWGCWC 1 cut(s) 13
AoxI GGCC 1 cut(s) 195
ApeKI GCWGC 3 cut(s) 53, 131, 188
AsuHPI GGTGA 1 cut(s) 56
BanII GRGCYC 1 cut(s) 13
Bbv12I GWGCWC 1 cut(s) 13
BbvI GCAGC 3 cut(s) 40, 118, 175
BccI CCATC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 158
BfaI CTAG 1 cut(s) 205
BglII AGATCT 1 cut(s) 79
BisI GCNGC 3 cut(s) 54, 132, 189
BlsI GCNGC 3 cut(s) 55, 133, 190
Bme1390I CCNGG 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 179
Bpu10I CCTNAGC 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 198
BsaWI WCCGGW 1 cut(s) 47
BsaXI ACNNNNNCTCC 2 cut(s) 152, 182
BseBI CCWGG 1 cut(s) 158
BseDI CCNNGG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 206
BseRI GAGGAG 2 cut(s) 31, 97
BseXI GCAGC 3 cut(s) 40, 118, 175
Bsh1285I CGRYCG 1 cut(s) 94
BshFI GGCC 1 cut(s) 197
BsiEI CGRYCG 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 13
BsiSI CCGG 2 cut(s) 48, 185
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 197
Bsp1286I GDGCHC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 2 cut(s) 94, 99
BspANI GGCC 1 cut(s) 197
BspCNI CTCAG 1 cut(s) 205
BsrBI CCGCTC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 192
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMCI CGRYCG 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 156
BstV1I GCAGC 3 cut(s) 40, 118, 175
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuRI GGCC 1 cut(s) 197
CviJI RGCY 5 cut(s) 11, 36, 53, 188, 197
CviKI_1 RGCY 5 cut(s) 11, 36, 53, 188, 197
DdeI CTNAG 1 cut(s) 192
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Ecl136II GAGCTC 1 cut(s) 11
Eco24I GRGCYC 1 cut(s) 13
Eco53kI GAGCTC 1 cut(s) 11
EcoICRI GAGCTC 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 156
EcoT38I GRGCYC 1 cut(s) 13
FblI GTMKAC 1 cut(s) 90
Fnu4HI GCNGC 3 cut(s) 54, 132, 189
FriOI GRGCYC 1 cut(s) 13
Fsp4HI GCNGC 3 cut(s) 54, 132, 189
FspBI CTAG 1 cut(s) 205
GluI GCNGC 3 cut(s) 54, 132, 189
GsuI CTGGAG 1 cut(s) 179
HaeIII GGCC 1 cut(s) 197
HapII CCGG 2 cut(s) 48, 185
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HinfI GANTC 3 cut(s) 147, 175, 181
HpaII CCGG 2 cut(s) 48, 185
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 2 cut(s) 91, 154
Hpy188I TCNGA 3 cut(s) 112, 174, 180
Hpy188III TCNNGA 2 cut(s) 137, 151
Hpy8I GTNNAC 2 cut(s) 91, 154
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 192
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 2 cut(s) 50, 160
LpnPI CCDG 7 cut(s) 7, 61, 80, 143, 170, 179, 198
Lsp1109I GCAGC 3 cut(s) 40, 118, 175
MaeI CTAG 1 cut(s) 205
MalI GATC 1 cut(s) 81
MbiI CCGCTC 1 cut(s) 101
MboI GATC 1 cut(s) 79
MflI RGATCY 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 13
MnlI CCTC 3 cut(s) 52, 118, 193
MspI CCGG 2 cut(s) 48, 185
MspR9I CCNGG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 1 cut(s) 79
NmeAIII GCCGAG 1 cut(s) 12
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 3 cut(s) 147, 175, 181
PkrI GCNGC 3 cut(s) 55, 133, 190
Psp124BI GAGCTC 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
PsuI RGATCY 1 cut(s) 79
SacI GAGCTC 1 cut(s) 13
SalI GTCGAC 1 cut(s) 89
SatI GCNGC 3 cut(s) 54, 132, 189
Sau3AI GATC 1 cut(s) 79
ScrFI CCNGG 1 cut(s) 158
SduI GDGCHC 1 cut(s) 13
SetI ASST 4 cut(s) 13, 55, 69, 159
SsiI CCGC 2 cut(s) 94, 99
SspMI CTAG 1 cut(s) 205
SstI GAGCTC 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 156
TaqI TCGA 1 cut(s) 90
TfiI GAWTC 3 cut(s) 147, 175, 181
TseI GCWGC 3 cut(s) 53, 131, 188
XmiI GTMKAC 1 cut(s) 90
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.