Prupe.1G484300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
40344761 .. 40347070
2310 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G484300.1

Sequence Viewer

Length: 561 bp
ATGGAGATGCAGAGCCTCTGCTCCAACAGCCTCGTTTTGGATGGTTTTCTCTCCTCTGTAGTGCAGGCTATGGTAGCTGAGGCAGCCATTGCTGCTGCCAAGTCTATTGCTTTGTCCTTCTGGATGATGGGATCTATTCCTAACACAACCACTGTTTTTCCCAAAGAACCTGAGGAACTCACAGGATTTCCTATCACTGAGCTTTTTGCAGTGGAAAAACCTGGTCCAGAGAACAAAGATGCAAGTGAAACTGAGGACGACGACGACGACGACGACGATGATGATGATGATGCTGCTGCTGGTGATGACCAGGATGATGATGGAGGTGATGCGGATGATGCCTCTGGGGAAGAGAATGAGGGTAAAGCAAATCCAGAAGACGAGCCTGAGGCCAATGGTGATGGTGTGAGCGAGGAGGATGGTGATGATGATGATGATGATGACGATGACGACGATGATGATGACGGTGATGATGGGGAGGAAGACACTGAGGACGATGAAGAGGATGAGGAAGATGAGGAGGAAGAGATACCTCAGCCACCTGCTAAGAGGAGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

187

Amino Acids

20.01

Weight (kDa)

4.05

Isoelectric Point (pI)

58.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017606)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g28660
malus_domestica MD08G1151900.v1.1 MD15G1129000.v1.1
prunus_persica Prupe.1G484300_v2.0.a1
pyrus_communis pycom08g13000 pycom15g11610
rosa_chinensis RchiOBHm_Chr6g0297441
rosa_laevigata RLG00000011598
rosa_multiflora Rmu_sc0004323.1_g000006
rosa_roxburghii Rroxscaffold_7G00170500
rosa_rugosa Rorug06G0272100
rosa_wichuraiana Rw6G033370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 550
Acc36I ACCTGC 1 cut(s) 550
AciI CCGC 1 cut(s) 332
AclWI GGATC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 37
AjnI CCWGG 2 cut(s) 220, 309
AluBI AGCT 2 cut(s) 77, 202
AluI AGCT 2 cut(s) 77, 202
AlwI GGATC 1 cut(s) 139
AoxI GGCC 1 cut(s) 390
ApeKI GCWGC 5 cut(s) 83, 92, 95, 293, 296
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 5 cut(s) 314, 338, 410, 434, 479
AvaII GGWCC 1 cut(s) 224
AxyI CCTNAGG 2 cut(s) 171, 387
BbsI GAAGAC 2 cut(s) 384, 489
BbvCI CCTCAGC 2 cut(s) 78, 534
BbvI GCAGC 5 cut(s) 79, 82, 95, 280, 283
BccI CCATC 6 cut(s) 35, 121, 314, 395, 413, 467
BciT130I CCWGG 2 cut(s) 222, 311
BfmI CTRYAG 1 cut(s) 57
BfuAI ACCTGC 1 cut(s) 550
BisI GCNGC 5 cut(s) 84, 93, 96, 294, 297
BlsI GCNGC 5 cut(s) 85, 94, 97, 295, 298
Bme1390I CCNGG 2 cut(s) 222, 311
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 222, 311
BmsI GCATC 4 cut(s) 229, 280, 319, 328
BpiI GAAGAC 2 cut(s) 384, 489
Bpu10I CCTNAGC 2 cut(s) 78, 534
Bsc4I CCNNNNNNNGG 1 cut(s) 37
Bse21I CCTNAGG 2 cut(s) 171, 387
Bse3DI GCAATG 1 cut(s) 87
BseBI CCWGG 2 cut(s) 222, 311
BseGI GGATG 6 cut(s) 46, 129, 319, 340, 424, 511
BseLI CCNNNNNNNGG 1 cut(s) 37
BseMI GCAATG 1 cut(s) 87
BseMII CTCAG 7 cut(s) 69, 162, 189, 243, 378, 480, 548
BseRI GAGGAG 3 cut(s) 43, 428, 533
BseXI GCAGC 5 cut(s) 79, 82, 95, 280, 283
BsgI GTGCAG 1 cut(s) 83
BshFI GGCC 1 cut(s) 392
BslI CCNNNNNNNGG 1 cut(s) 37
BsnI GGCC 1 cut(s) 392
Bsp143I GATC 1 cut(s) 131
BspACI CCGC 1 cut(s) 332
BspANI GGCC 1 cut(s) 392
BspCNI CTCAG 7 cut(s) 70, 163, 190, 244, 379, 481, 547
BspMI ACCTGC 1 cut(s) 550
BspPI GGATC 1 cut(s) 139
BsrDI GCAATG 1 cut(s) 87
BssMI GATC 1 cut(s) 131
Bst2UI CCWGG 2 cut(s) 222, 311
Bst4CI ACNGT 2 cut(s) 154, 467
Bst6I CTCTTC 3 cut(s) 345, 495, 519
BstAPI GCANNNNNTGC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 8 cut(s) 78, 171, 198, 252, 387, 489, 534, 546
BstF5I GGATG 6 cut(s) 46, 129, 319, 340, 424, 511
BstKTI GATC 1 cut(s) 134
BstMBI GATC 1 cut(s) 131
BstMWI GCNNNNNNNGC 6 cut(s) 27, 74, 83, 89, 92, 338
BstNI CCWGG 2 cut(s) 222, 311
BstSCI CCNGG 2 cut(s) 220, 309
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 5 cut(s) 79, 82, 95, 280, 283
BstV2I GAAGAC 2 cut(s) 384, 489
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
Bsu36I CCTNAGG 2 cut(s) 171, 387
BsuRI GGCC 1 cut(s) 392
BtsCI GGATG 6 cut(s) 46, 129, 319, 340, 424, 511
BtsI GCAGTG 1 cut(s) 216
BtsIMutI CAGTG 4 cut(s) 150, 195, 216, 486
BveI ACCTGC 1 cut(s) 550
Cac8I GCNNGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 224
CsiI ACCWGGT 1 cut(s) 220
CviJI RGCY 9 cut(s) 15, 30, 68, 77, 86, 202, 385, 392, 538
CviKI_1 RGCY 9 cut(s) 15, 30, 68, 77, 86, 202, 385, 392, 538
DdeI CTNAG 8 cut(s) 78, 171, 198, 252, 387, 489, 534, 546
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
Eam1104I CTCTTC 3 cut(s) 345, 495, 519
EarI CTCTTC 3 cut(s) 345, 495, 519
Eco47I GGWCC 1 cut(s) 224
Eco81I CCTNAGG 2 cut(s) 171, 387
EcoRII CCWGG 2 cut(s) 220, 309
FaiI YATR 1 cut(s) 71
Fnu4HI GCNGC 5 cut(s) 84, 93, 96, 294, 297
FokI GGATG 6 cut(s) 53, 136, 326, 347, 431, 518
Fsp4HI GCNGC 5 cut(s) 84, 93, 96, 294, 297
GluI GCNGC 5 cut(s) 84, 93, 96, 294, 297
HaeIII GGCC 1 cut(s) 392
HphI GGTGA 5 cut(s) 314, 338, 410, 434, 479
Hpy188III TCNNGA 3 cut(s) 121, 227, 374
Hpy99I CGWCG 7 cut(s) 263, 266, 269, 272, 275, 278, 455
HpyAV CCTTC 1 cut(s) 127
HpyCH4III ACNGT 2 cut(s) 154, 467
HpyCH4V TGCA 4 cut(s) 10, 64, 209, 242
HpyF10VI GCNNNNNNNGC 6 cut(s) 27, 74, 83, 89, 92, 338
HpyF3I CTNAG 8 cut(s) 78, 171, 198, 252, 387, 489, 534, 546
Kzo9I GATC 1 cut(s) 131
LmnI GCTCC 1 cut(s) 26
Lsp1109I GCAGC 5 cut(s) 79, 82, 95, 280, 283
LweI GCATC 4 cut(s) 229, 280, 319, 328
MabI ACCWGGT 1 cut(s) 220
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 6 cut(s) 362, 389, 494, 512, 524, 536
MflI RGATCY 1 cut(s) 131
MmeI TCCRAC 1 cut(s) 48
MspR9I CCNGG 2 cut(s) 222, 311
MvaI CCWGG 2 cut(s) 222, 311
MwoI GCNNNNNNNGC 6 cut(s) 27, 74, 83, 89, 92, 338
NdeII GATC 1 cut(s) 131
PaqCI CACCTGC 1 cut(s) 550
PcsI WCGNNNNNNNCGW 5 cut(s) 264, 267, 270, 273, 450
PkrI GCNGC 5 cut(s) 85, 94, 97, 295, 298
Psp6I CCWGG 2 cut(s) 220, 309
PspGI CCWGG 2 cut(s) 220, 309
PspPI GGNCC 1 cut(s) 224
PsuI RGATCY 1 cut(s) 131
SatI GCNGC 5 cut(s) 84, 93, 96, 294, 297
Sau3AI GATC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 222, 311
SetI ASST 7 cut(s) 79, 172, 204, 223, 328, 535, 544
SexAI ACCWGGT 1 cut(s) 220
SfaNI GCATC 4 cut(s) 229, 280, 319, 328
SfcI CTRYAG 1 cut(s) 57
SinI GGWCC 1 cut(s) 224
SsiI CCGC 1 cut(s) 332
StyD4I CCNGG 2 cut(s) 220, 309
TaaI ACNGT 2 cut(s) 154, 467
TscAI CASTG 4 cut(s) 157, 202, 216, 493
TseI GCWGC 5 cut(s) 83, 92, 95, 293, 296
TspDTI ATGAA 1 cut(s) 513
TspRI CASTG 4 cut(s) 157, 202, 216, 493
VpaK11BI GGWCC 1 cut(s) 224
XcmI CCANNNNNNNNNTGG 1 cut(s) 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.