Prupe.1G559200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
45651976 .. 45659190
7215 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G559200.4

Sequence Viewer

Length: 405 bp
ATGGCTGATTCCAAACCTACAACTAGCATGAGATGCCATCATTGTGCTGGTCCTCTTTCTAAGGAGATGGAAACTAGCGGGTGGACCGTTCCACCTCTTATTAGGGATAGCTTTTCTATGATTGGCTCTGCGGTTGGTGGCACAGCAAGTGCTTTTTATGGATTCAACCATGTGATGCCTGTTGTTCGGAGATGGGTAAAAGGACCTATGTGGTTACATTTTTTCATTGGTGCTCCGCCTGTGATTGTATTCTCTTCAGCTTGTGCAGGTTTGGCAGGTGGGGCTGTTCCAGCCTTGGCCCAACTTGCTTCTTCCTCGTATCGTGCAGTGGTCTCATCGTCCTCGTTGCCTCCAACATCTGAAGACGAGAAGATTCACAAGTCCAGAACTTCCTCTACTCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

14.14

Weight (kDa)

9.26

Isoelectric Point (pI)

57.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 266
Acc36I ACCTGC 2 cut(s) 257, 266
AciI CCGC 3 cut(s) 78, 131, 236
AcuI CTGAAG 2 cut(s) 240, 381
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 2 cut(s) 111, 260
AluI AGCT 2 cut(s) 111, 260
Alw21I GWGCWC 1 cut(s) 235
Alw26I GTCTC 1 cut(s) 337
AoxI GGCC 1 cut(s) 297
AspS9I GGNCC 4 cut(s) 50, 84, 203, 298
AvaII GGWCC 3 cut(s) 50, 84, 203
BbsI GAAGAC 1 cut(s) 369
Bbv12I GWGCWC 1 cut(s) 235
BccI CCATC 3 cut(s) 45, 61, 186
BcoDI GTCTC 1 cut(s) 337
BfaI CTAG 2 cut(s) 24, 75
BfuAI ACCTGC 2 cut(s) 257, 266
Bme18I GGWCC 3 cut(s) 50, 84, 203
BmgT120I GGNCC 4 cut(s) 50, 84, 203, 298
BmsI GCATC 2 cut(s) 23, 165
BpiI GAAGAC 1 cut(s) 369
BsaI GGTCTC 1 cut(s) 337
BsaJI CCNNGG 1 cut(s) 294
BseDI CCNNGG 1 cut(s) 294
BsgI GTGCAG 2 cut(s) 285, 345
BshFI GGCC 1 cut(s) 299
BsiHKAI GWGCWC 1 cut(s) 235
BsmAI GTCTC 1 cut(s) 337
BsnI GGCC 1 cut(s) 299
Bso31I GGTCTC 1 cut(s) 337
Bsp1286I GDGCHC 1 cut(s) 235
BspACI CCGC 3 cut(s) 78, 131, 236
BspANI GGCC 1 cut(s) 299
BspMI ACCTGC 2 cut(s) 257, 266
BspTNI GGTCTC 1 cut(s) 337
BssECI CCNNGG 1 cut(s) 294
BssT1I CCWWGG 1 cut(s) 294
Bst4CI ACNGT 1 cut(s) 88
Bst6I CTCTTC 1 cut(s) 259
BstAPI GCANNNNNTGC 1 cut(s) 33
BstDEI CTNAG 1 cut(s) 60
BstMAI GTCTC 1 cut(s) 337
BstMWI GCNNNNNNNGC 5 cut(s) 33, 272, 281, 290, 305
BstV2I GAAGAC 1 cut(s) 369
BsuRI GGCC 1 cut(s) 299
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 1 cut(s) 333
BveI ACCTGC 2 cut(s) 257, 266
Cfr13I GGNCC 4 cut(s) 50, 84, 203, 298
CviAII CATG 2 cut(s) 28, 170
CviJI RGCY 7 cut(s) 5, 111, 126, 260, 284, 293, 299
CviKI_1 RGCY 7 cut(s) 5, 111, 126, 260, 284, 293, 299
DdeI CTNAG 1 cut(s) 60
Eam1104I CTCTTC 1 cut(s) 259
EarI CTCTTC 1 cut(s) 259
EciI GGCGGA 1 cut(s) 225
Eco130I CCWWGG 1 cut(s) 294
Eco31I GGTCTC 1 cut(s) 337
Eco47I GGWCC 3 cut(s) 50, 84, 203
Eco57I CTGAAG 2 cut(s) 240, 381
EcoO109I RGGNCCY 1 cut(s) 203
EcoT14I CCWWGG 1 cut(s) 294
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 2 cut(s) 31, 173
FaiI YATR 5 cut(s) 29, 119, 159, 171, 209
FatI CATG 2 cut(s) 27, 169
FauI CCCGC 1 cut(s) 71
FspBI CTAG 2 cut(s) 24, 75
HaeIII GGCC 1 cut(s) 299
Hin1II CATG 2 cut(s) 31, 173
HinfI GANTC 3 cut(s) 8, 162, 373
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 189, 361
Hpy188III TCNNGA 1 cut(s) 384
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4V TGCA 2 cut(s) 266, 326
HpyF10VI GCNNNNNNNGC 5 cut(s) 33, 272, 281, 290, 305
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 2 cut(s) 31, 173
LmnI GCTCC 1 cut(s) 238
LpnPI CCDG 7 cut(s) 33, 192, 252, 252, 261, 303, 397
LweI GCATC 2 cut(s) 23, 165
MaeI CTAG 2 cut(s) 24, 75
MaeIII GTNAC 1 cut(s) 213
MboII GAAGA 4 cut(s) 246, 303, 374, 382
MhlI GDGCHC 1 cut(s) 235
MmeI TCCRAC 1 cut(s) 377
MnlI CCTC 6 cut(s) 63, 105, 325, 352, 360, 403
MslI CAYNNNNRTG 1 cut(s) 42
MwoI GCNNNNNNNGC 5 cut(s) 33, 272, 281, 290, 305
NlaIII CATG 2 cut(s) 31, 173
PaqCI CACCTGC 1 cut(s) 266
PfeI GAWTC 3 cut(s) 8, 162, 373
PpuMI RGGWCCY 1 cut(s) 203
Psp5II RGGWCCY 1 cut(s) 203
PspPI GGNCC 4 cut(s) 50, 84, 203, 298
PspPPI RGGWCCY 1 cut(s) 203
PsrI GAACNNNNNNTAC 1 cut(s) 379
RseI CAYNNNNRTG 1 cut(s) 42
Sau96I GGNCC 4 cut(s) 50, 84, 203, 298
SduI GDGCHC 1 cut(s) 235
SetI ASST 7 cut(s) 19, 97, 113, 208, 262, 271, 280
SfaNI GCATC 2 cut(s) 23, 165
SinI GGWCC 3 cut(s) 50, 84, 203
SmiMI CAYNNNNRTG 1 cut(s) 42
SsiI CCGC 3 cut(s) 78, 131, 236
SspMI CTAG 2 cut(s) 24, 75
StyI CCWWGG 1 cut(s) 294
TaaI ACNGT 1 cut(s) 88
TfiI GAWTC 3 cut(s) 8, 162, 373
TscAI CASTG 1 cut(s) 333
TspDTI ATGAA 1 cut(s) 214
TspRI CASTG 1 cut(s) 333
VpaK11BI GGWCC 3 cut(s) 50, 84, 203
XcmI CCANNNNNNNNNTGG 1 cut(s) 44
XspI CTAG 2 cut(s) 24, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.