Prupe.3G024300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
1796111 .. 1796554
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G024300.1

Sequence Viewer

Length: 444 bp
ATGGAACAGCCATCCTTCAACTCTCTCCCTCAAAACCCCAACACATCATCTTCCACAGCCAAACCCAAAACCCCAAATACCCAAAAGAAAAAGCTACCAACCCCACAAGAACTCATCTCCCACTATGAGTCCCAAGGCCTTGACACCCAAGAGGCCTCTCTCAAGGTCATAGGTGACCTCCAGGCTGCCCTCTTTAGGGTCATAACCTCTGGCAGAGGCAGAAAGGACAAGCTCTTGGCTGAGACCTCAAGAAAGATTGACAGCACCAACAACAGCCTTGCCATTCTTAATATGAAGATTGACTCCAAGCCTGGCTATGGTGAAGCTTTTGGTATTGGGGTTGCTTCTGGGGTGACTTTGAAAGGCATTGAGACTGTTCTGCCTCATGTTCTTGGGGGTTTTGGACAGATTTGGAACACTGTCAGGAATGCCACTAAGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

15.83

Weight (kDa)

9.56

Isoelectric Point (pI)

28.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016199)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G16790
fragaria_vesca FvH4_6g36820
malus_domestica MD09G1166600.v1.1
prunus_persica Prupe.3G024300_v2.0.a1
pyrus_communis pycom09g08410 pycom17g15410
rosa_chinensis RchiOBHm_Chr2g0149211
rosa_laevigata RLG00000020383
rosa_multiflora Rmu_co8096518.1_g000001 Rmu_sc0001615.1_g000004
rosa_roxburghii Rroxscaffold_2G00098310
rosa_rugosa Rorug02G0409800
rosa_samantha Rh2AG470300 Rh2CG456200
rosa_wichuraiana Rw2G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 3 cut(s) 195, 196, 317
AgsI TTSAA 2 cut(s) 19, 361
AjnI CCWGG 2 cut(s) 180, 310
AluBI AGCT 3 cut(s) 94, 232, 326
AluI AGCT 3 cut(s) 94, 232, 326
Alw26I GTCTC 2 cut(s) 236, 365
AoxI GGCC 2 cut(s) 136, 153
ApeKI GCWGC 1 cut(s) 185
AsuHPI GGTGA 3 cut(s) 185, 332, 364
BbvI GCAGC 1 cut(s) 172
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 2 cut(s) 182, 312
BcoDI GTCTC 2 cut(s) 236, 365
BisI GCNGC 1 cut(s) 186
BlsI GCNGC 1 cut(s) 187
Bme1390I CCNGG 2 cut(s) 182, 312
BmrFI CCNGG 2 cut(s) 182, 312
BpmI CTGGAG 1 cut(s) 164
BpuEI CTTGAG 2 cut(s) 146, 232
BsaI GGTCTC 1 cut(s) 236
BsaJI CCNNGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 3 cut(s) 195, 196, 317
BseBI CCWGG 2 cut(s) 182, 312
BseDI CCNNGG 1 cut(s) 133
BseGI GGATG 1 cut(s) 11
BseLI CCNNNNNNNGG 3 cut(s) 195, 196, 317
BseMII CTCAG 1 cut(s) 231
BseXI GCAGC 1 cut(s) 172
BshFI GGCC 2 cut(s) 138, 155
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 3 cut(s) 195, 196, 317
BsmAI GTCTC 2 cut(s) 236, 365
BsmFI GGGAC 1 cut(s) 115
BsmI GAATGC 1 cut(s) 433
BsnI GGCC 2 cut(s) 138, 155
Bso31I GGTCTC 1 cut(s) 236
BspANI GGCC 2 cut(s) 138, 155
BspCNI CTCAG 1 cut(s) 232
BspTNI GGTCTC 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 133
BssT1I CCWWGG 1 cut(s) 133
Bst2UI CCWGG 2 cut(s) 182, 312
Bst4CI ACNGT 2 cut(s) 376, 421
BstDEI CTNAG 2 cut(s) 240, 435
BstEII GGTNACC 1 cut(s) 173
BstF5I GGATG 1 cut(s) 11
BstMAI GTCTC 2 cut(s) 236, 365
BstNI CCWGG 2 cut(s) 182, 312
BstPI GGTNACC 1 cut(s) 173
BstSCI CCNGG 2 cut(s) 180, 310
BstV1I GCAGC 1 cut(s) 172
BsuRI GGCC 2 cut(s) 138, 155
BtsCI GGATG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 417
CviAII CATG 1 cut(s) 386
DdeI CTNAG 2 cut(s) 240, 435
Eco130I CCWWGG 1 cut(s) 133
Eco147I AGGCCT 2 cut(s) 138, 155
Eco31I GGTCTC 1 cut(s) 236
Eco91I GGTNACC 1 cut(s) 173
EcoO65I GGTNACC 1 cut(s) 173
EcoRII CCWGG 2 cut(s) 180, 310
EcoT14I CCWWGG 1 cut(s) 133
ErhI CCWWGG 1 cut(s) 133
FaeI CATG 1 cut(s) 389
FaiI YATR 6 cut(s) 126, 170, 203, 293, 318, 387
FaqI GGGAC 1 cut(s) 115
FatI CATG 1 cut(s) 385
Fnu4HI GCNGC 1 cut(s) 186
Fsp4HI GCNGC 1 cut(s) 186
GluI GCNGC 1 cut(s) 186
GsuI CTGGAG 1 cut(s) 164
HaeIII GGCC 2 cut(s) 138, 155
Hin1II CATG 1 cut(s) 389
HindIII AAGCTT 1 cut(s) 324
HinfI GANTC 2 cut(s) 128, 302
HphI GGTGA 3 cut(s) 185, 332, 364
Hpy188III TCNNGA 2 cut(s) 249, 424
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 2 cut(s) 376, 421
HpyF3I CTNAG 2 cut(s) 240, 435
Hsp92II CATG 1 cut(s) 389
LpnPI CCDG 7 cut(s) 167, 194, 195, 297, 324, 333, 409
Lsp1109I GCAGC 1 cut(s) 172
MaeIII GTNAC 2 cut(s) 173, 352
MboII GAAGA 2 cut(s) 42, 307
MlyI GAGTC 2 cut(s) 137, 296
MnlI CCTC 9 cut(s) 39, 145, 166, 188, 200, 209, 217, 256, 393
MseI TTAA 1 cut(s) 288
MspR9I CCNGG 2 cut(s) 182, 312
Mva1269I GAATGC 1 cut(s) 433
MvaI CCWGG 2 cut(s) 182, 312
NlaIII CATG 1 cut(s) 389
NmuCI GTSAC 2 cut(s) 173, 352
PceI AGGCCT 2 cut(s) 138, 155
PctI GAATGC 1 cut(s) 433
PkrI GCNGC 1 cut(s) 187
PleI GAGTC 2 cut(s) 136, 296
PpsI GAGTC 2 cut(s) 136, 296
Psp6I CCWGG 2 cut(s) 180, 310
PspEI GGTNACC 1 cut(s) 173
PspGI CCWGG 2 cut(s) 180, 310
SaqAI TTAA 1 cut(s) 288
SatI GCNGC 1 cut(s) 186
SchI GAGTC 2 cut(s) 137, 296
ScrFI CCNGG 2 cut(s) 182, 312
SetI ASST 8 cut(s) 96, 168, 175, 180, 209, 234, 248, 328
SmlI CTYRAG 2 cut(s) 161, 247
SmoI CTYRAG 2 cut(s) 161, 247
SseBI AGGCCT 2 cut(s) 138, 155
StuI AGGCCT 2 cut(s) 138, 155
StyD4I CCNGG 2 cut(s) 180, 310
StyI CCWWGG 1 cut(s) 133
TaaI ACNGT 2 cut(s) 376, 421
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 424
TseFI GTSAC 2 cut(s) 173, 352
TseI GCWGC 1 cut(s) 185
Tsp45I GTSAC 2 cut(s) 173, 352
TspDTI ATGAA 1 cut(s) 308
TspRI CASTG 1 cut(s) 424
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.