Rmu_sc0001615.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001615.1
Physical Location & Seq
Forward (+)
21605 .. 22042
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001615.1_g000004.1.cds

Sequence Viewer

Length: 438 bp
atggaacaacaaccactgaccccaaactccaacccccaaaaacccaccaaattcacagacccgaatgccctgaagaaaaagctgcctaccccacaagagctcatctcccactatgaatcccaagggcttgacacccaagaagcctctctcagggtcataggggacctccagactgccctcttcagggtcatatcctctggaagaggcagaaaggacaagcttttggctgagacttcaagaaaagttgacaacaccaacaacagccttgccattcttaacatgaagctcgactccaagcctggctatggcgagtcttttgctattgggcttgcttctgggctcaccttccaaggcgttcagagtgttctgcctcatgtattcaagggttttggagacatttggaattctgtcaggaatgtcgaaaaggaaaatccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

15.98

Weight (kDa)

9.22

Isoelectric Point (pI)

29.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016199)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G16790
fragaria_vesca FvH4_6g36820
malus_domestica MD09G1166600.v1.1
prunus_persica Prupe.3G024300_v2.0.a1
pyrus_communis pycom09g08410 pycom17g15410
rosa_chinensis RchiOBHm_Chr2g0149211
rosa_laevigata RLG00000020383
rosa_multiflora Rmu_co8096518.1_g000001 Rmu_sc0001615.1_g000004
rosa_roxburghii Rroxscaffold_2G00098310
rosa_rugosa Rorug02G0409800
rosa_samantha Rh2AG470300 Rh2CG456200
rosa_wichuraiana Rw2G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 50, 403
AcuI CTGAAG 2 cut(s) 92, 166
AfiI CCNNNNNNNGG 4 cut(s) 150, 183, 184, 305
AgsI TTSAA 2 cut(s) 237, 382
AjnI CCWGG 1 cut(s) 298
AluBI AGCT 4 cut(s) 82, 100, 220, 286
AluI AGCT 4 cut(s) 82, 100, 220, 286
Alw21I GWGCWC 1 cut(s) 102
Alw26I GTCTC 2 cut(s) 224, 387
ApeKI GCWGC 1 cut(s) 82
ApoI RAATTY 2 cut(s) 50, 403
AspS9I GGNCC 1 cut(s) 163
AsuHPI GGTGA 1 cut(s) 334
AvaII GGWCC 1 cut(s) 163
BanII GRGCYC 2 cut(s) 102, 342
Bbv12I GWGCWC 1 cut(s) 102
BbvI GCAGC 1 cut(s) 69
BcgI CGANNNNNNTGC 2 cut(s) 299, 333
BciT130I CCWGG 1 cut(s) 300
BcoDI GTCTC 2 cut(s) 224, 387
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
Bme1390I CCNGG 1 cut(s) 300
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 300
BplI GAGNNNNNCTC 2 cut(s) 89, 121
BpmI CTGGAG 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 121, 349
Bsc4I CCNNNNNNNGG 4 cut(s) 150, 183, 184, 305
BseBI CCWGG 1 cut(s) 300
BseDI CCNNGG 2 cut(s) 121, 349
BseLI CCNNNNNNNGG 4 cut(s) 150, 183, 184, 305
BseMII CTCAG 2 cut(s) 163, 219
BseXI GCAGC 1 cut(s) 69
BsiHKAI GWGCWC 1 cut(s) 102
BslFI GGGAC 1 cut(s) 176
BslI CCNNNNNNNGG 4 cut(s) 150, 183, 184, 305
BsmAI GTCTC 2 cut(s) 224, 387
BsmFI GGGAC 1 cut(s) 176
BsmI GAATGC 1 cut(s) 70
Bsp1286I GDGCHC 2 cut(s) 102, 342
BspCNI CTCAG 2 cut(s) 162, 220
BspLI GGNNCC 1 cut(s) 164
BssECI CCNNGG 2 cut(s) 121, 349
BssT1I CCWWGG 2 cut(s) 121, 349
Bst2UI CCWGG 1 cut(s) 300
Bst6I CTCTTC 2 cut(s) 185, 196
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 2 cut(s) 149, 228
BstENI CCTNNNNNAGG 1 cut(s) 148
BstMAI GTCTC 2 cut(s) 224, 387
BstNI CCWGG 1 cut(s) 300
BstSCI CCNGG 1 cut(s) 298
BstV1I GCAGC 1 cut(s) 69
BtsIMutI CAGTG 1 cut(s) 14
Cac8I GCNNGC 1 cut(s) 330
Cfr13I GGNCC 1 cut(s) 163
CviAII CATG 2 cut(s) 280, 374
DdeI CTNAG 2 cut(s) 149, 228
Eam1104I CTCTTC 2 cut(s) 185, 196
EarI CTCTTC 2 cut(s) 185, 196
Ecl136II GAGCTC 1 cut(s) 100
Eco130I CCWWGG 2 cut(s) 121, 349
Eco24I GRGCYC 2 cut(s) 102, 342
Eco47I GGWCC 1 cut(s) 163
Eco53kI GAGCTC 1 cut(s) 100
Eco57I CTGAAG 2 cut(s) 92, 166
EcoICRI GAGCTC 1 cut(s) 100
EcoNI CCTNNNNNAGG 1 cut(s) 148
EcoO109I RGGNCCY 1 cut(s) 163
EcoRI GAATTC 1 cut(s) 403
EcoRII CCWGG 1 cut(s) 298
EcoT14I CCWWGG 2 cut(s) 121, 349
EcoT38I GRGCYC 2 cut(s) 102, 342
ErhI CCWWGG 2 cut(s) 121, 349
FaeI CATG 2 cut(s) 283, 377
FaiI YATR 6 cut(s) 114, 158, 191, 281, 306, 375
FaqI GGGAC 1 cut(s) 176
FatI CATG 2 cut(s) 279, 373
Fnu4HI GCNGC 1 cut(s) 83
FriOI GRGCYC 2 cut(s) 102, 342
Fsp4HI GCNGC 1 cut(s) 83
GluI GCNGC 1 cut(s) 83
GsuI CTGGAG 1 cut(s) 152
Hin1II CATG 2 cut(s) 283, 377
HincII GTYRAC 1 cut(s) 247
HindII GTYRAC 1 cut(s) 247
HindIII AAGCTT 1 cut(s) 218
HinfI GANTC 3 cut(s) 116, 290, 311
HphI GGTGA 1 cut(s) 334
Hpy166II GTNNAC 1 cut(s) 247
Hpy188I TCNGA 1 cut(s) 360
Hpy188III TCNNGA 4 cut(s) 169, 198, 237, 412
Hpy8I GTNNAC 1 cut(s) 247
HpyAV CCTTC 1 cut(s) 355
HpyF3I CTNAG 2 cut(s) 149, 228
Hsp92II CATG 2 cut(s) 283, 377
LpnPI CCDG 9 cut(s) 83, 136, 169, 182, 183, 285, 312, 321, 397
Lsp1109I GCAGC 1 cut(s) 69
MboII GAAGA 3 cut(s) 85, 172, 213
MhlI GDGCHC 2 cut(s) 102, 342
MluCI AATT 2 cut(s) 50, 403
MlyI GAGTC 2 cut(s) 284, 320
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 6 cut(s) 154, 176, 188, 197, 205, 381
MseI TTAA 1 cut(s) 276
MspR9I CCNGG 1 cut(s) 300
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 300
NlaIII CATG 2 cut(s) 283, 377
NlaIV GGNNCC 1 cut(s) 164
PctI GAATGC 1 cut(s) 70
PfeI GAWTC 1 cut(s) 116
PkrI GCNGC 1 cut(s) 84
PleI GAGTC 2 cut(s) 284, 319
PpsI GAGTC 2 cut(s) 284, 319
PpuMI RGGWCCY 1 cut(s) 163
Psp124BI GAGCTC 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 298
PspGI CCWGG 1 cut(s) 298
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 1 cut(s) 163
PspPPI RGGWCCY 1 cut(s) 163
SacI GAGCTC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 276
SatI GCNGC 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 163
SchI GAGTC 2 cut(s) 284, 320
ScrFI CCNGG 1 cut(s) 300
SduI GDGCHC 2 cut(s) 102, 342
SetI ASST 6 cut(s) 84, 102, 168, 222, 288, 347
SinI GGWCC 1 cut(s) 163
Sse9I AATT 2 cut(s) 50, 403
SstI GAGCTC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 298
StyI CCWWGG 2 cut(s) 121, 349
TaqI TCGA 2 cut(s) 288, 420
TasI AATT 2 cut(s) 50, 403
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TscAI CASTG 1 cut(s) 21
TseI GCWGC 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 129, 296
TspRI CASTG 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 163
XagI CCTNNNNNAGG 1 cut(s) 148
XapI RAATTY 2 cut(s) 50, 403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.