Rh2CG456200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
61983788 .. 61984920
1133 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG456200.1

Sequence Viewer

Length: 435 bp
ATGGAACAACCACTGACCCCAAACTCCAACCCCCAAAAACCCACCAAATTCACAGACCCGAATGCCCTGAAGAAAAAGCTGCCTACCCCACAAGAGCTCATCTCCCACTATGAATCCCAAGGGCTTGACACCCAAGAAGCCTCTCTCAAGGTCATAGGGGACCTCCAGACTGCCCTCTTCAGGGTCATATCCTCTGGAAGAGGCAGAAAGGACAAGCTTTTGGCTGAGACTTCAAGAAAAGTTGACAACACCAACAACAGCCTTGCCATTCTTAACATGAAGCTCGACTCCAAGCCTGGCTATGGTGAGTCTTTTGCTATTGGGCTTGCTTCTGGGCTCACCTTCCAAGGCGTTCAGAGTGTTCTGCCTCATGTATTCAAGGGTTTTGGAGACATTTGGAATTCTGTCAGGAATGTCGAAAAGGAAAATCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

144

Amino Acids

15.82

Weight (kDa)

9.19

Isoelectric Point (pI)

26.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016199)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G16790
fragaria_vesca FvH4_6g36820
malus_domestica MD09G1166600.v1.1
prunus_persica Prupe.3G024300_v2.0.a1
pyrus_communis pycom09g08410 pycom17g15410
rosa_chinensis RchiOBHm_Chr2g0149211
rosa_laevigata RLG00000020383
rosa_multiflora Rmu_co8096518.1_g000001 Rmu_sc0001615.1_g000004
rosa_roxburghii Rroxscaffold_2G00098310
rosa_rugosa Rorug02G0409800
rosa_samantha Rh2AG470300 Rh2CG456200
rosa_wichuraiana Rw2G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 47, 400
AcuI CTGAAG 2 cut(s) 89, 163
AfiI CCNNNNNNNGG 3 cut(s) 180, 181, 302
AgsI TTSAA 2 cut(s) 234, 379
AjnI CCWGG 1 cut(s) 295
AluBI AGCT 4 cut(s) 79, 97, 217, 283
AluI AGCT 4 cut(s) 79, 97, 217, 283
Alw21I GWGCWC 1 cut(s) 99
Alw26I GTCTC 2 cut(s) 221, 384
ApeKI GCWGC 1 cut(s) 79
ApoI RAATTY 2 cut(s) 47, 400
AspS9I GGNCC 1 cut(s) 160
AsuHPI GGTGA 2 cut(s) 317, 331
AvaII GGWCC 1 cut(s) 160
BanII GRGCYC 2 cut(s) 99, 339
Bbv12I GWGCWC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 297
BcoDI GTCTC 2 cut(s) 221, 384
BisI GCNGC 1 cut(s) 80
BlsI GCNGC 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 297
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 160
BmiI GGNNCC 1 cut(s) 161
BmrFI CCNGG 1 cut(s) 297
BplI GAGNNNNNCTC 2 cut(s) 86, 118
BpmI CTGGAG 1 cut(s) 149
BpuEI CTTGAG 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 118, 346
Bsc4I CCNNNNNNNGG 3 cut(s) 180, 181, 302
BseBI CCWGG 1 cut(s) 297
BseDI CCNNGG 2 cut(s) 118, 346
BseLI CCNNNNNNNGG 3 cut(s) 180, 181, 302
BseMII CTCAG 1 cut(s) 216
BseXI GCAGC 1 cut(s) 66
BsiHKAI GWGCWC 1 cut(s) 99
BslFI GGGAC 1 cut(s) 173
BslI CCNNNNNNNGG 3 cut(s) 180, 181, 302
BsmAI GTCTC 2 cut(s) 221, 384
BsmFI GGGAC 1 cut(s) 173
BsmI GAATGC 1 cut(s) 67
Bsp1286I GDGCHC 2 cut(s) 99, 339
BspCNI CTCAG 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 161
BssECI CCNNGG 2 cut(s) 118, 346
BssT1I CCWWGG 2 cut(s) 118, 346
Bst2UI CCWGG 1 cut(s) 297
Bst6I CTCTTC 2 cut(s) 182, 193
BstC8I GCNNGC 1 cut(s) 327
BstDEI CTNAG 1 cut(s) 225
BstMAI GTCTC 2 cut(s) 221, 384
BstNI CCWGG 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 295
BstV1I GCAGC 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 327
Cfr13I GGNCC 1 cut(s) 160
CviAII CATG 2 cut(s) 277, 371
DdeI CTNAG 1 cut(s) 225
Eam1104I CTCTTC 2 cut(s) 182, 193
EarI CTCTTC 2 cut(s) 182, 193
Ecl136II GAGCTC 1 cut(s) 97
Eco130I CCWWGG 2 cut(s) 118, 346
Eco24I GRGCYC 2 cut(s) 99, 339
Eco47I GGWCC 1 cut(s) 160
Eco53kI GAGCTC 1 cut(s) 97
Eco57I CTGAAG 2 cut(s) 89, 163
EcoICRI GAGCTC 1 cut(s) 97
EcoO109I RGGNCCY 1 cut(s) 160
EcoRI GAATTC 1 cut(s) 400
EcoRII CCWGG 1 cut(s) 295
EcoT14I CCWWGG 2 cut(s) 118, 346
EcoT38I GRGCYC 2 cut(s) 99, 339
ErhI CCWWGG 2 cut(s) 118, 346
FaeI CATG 2 cut(s) 280, 374
FaiI YATR 6 cut(s) 111, 155, 188, 278, 303, 372
FaqI GGGAC 1 cut(s) 173
FatI CATG 2 cut(s) 276, 370
Fnu4HI GCNGC 1 cut(s) 80
FriOI GRGCYC 2 cut(s) 99, 339
Fsp4HI GCNGC 1 cut(s) 80
GluI GCNGC 1 cut(s) 80
GsuI CTGGAG 1 cut(s) 149
Hin1II CATG 2 cut(s) 280, 374
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 3 cut(s) 113, 287, 308
HphI GGTGA 2 cut(s) 317, 331
Hpy166II GTNNAC 1 cut(s) 244
Hpy188I TCNGA 1 cut(s) 357
Hpy188III TCNNGA 4 cut(s) 166, 195, 234, 409
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 1 cut(s) 352
HpyF3I CTNAG 1 cut(s) 225
Hsp92II CATG 2 cut(s) 280, 374
LpnPI CCDG 8 cut(s) 80, 166, 179, 180, 282, 309, 318, 394
Lsp1109I GCAGC 1 cut(s) 66
MboII GAAGA 3 cut(s) 82, 169, 210
MhlI GDGCHC 2 cut(s) 99, 339
MluCI AATT 2 cut(s) 47, 400
MlyI GAGTC 2 cut(s) 281, 317
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 6 cut(s) 151, 173, 185, 194, 202, 378
MseI TTAA 1 cut(s) 273
MspR9I CCNGG 1 cut(s) 297
Mva1269I GAATGC 1 cut(s) 67
MvaI CCWGG 1 cut(s) 297
NlaIII CATG 2 cut(s) 280, 374
NlaIV GGNNCC 1 cut(s) 161
PctI GAATGC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 81
PleI GAGTC 2 cut(s) 281, 316
PpsI GAGTC 2 cut(s) 281, 316
PpuMI RGGWCCY 1 cut(s) 160
Psp124BI GAGCTC 1 cut(s) 99
Psp5II RGGWCCY 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 295
PspGI CCWGG 1 cut(s) 295
PspN4I GGNNCC 1 cut(s) 161
PspPI GGNCC 1 cut(s) 160
PspPPI RGGWCCY 1 cut(s) 160
SacI GAGCTC 1 cut(s) 99
SaqAI TTAA 1 cut(s) 273
SatI GCNGC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 160
SchI GAGTC 2 cut(s) 281, 317
ScrFI CCNGG 1 cut(s) 297
SduI GDGCHC 2 cut(s) 99, 339
SetI ASST 7 cut(s) 81, 99, 153, 165, 219, 285, 344
SinI GGWCC 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 2 cut(s) 47, 400
SstI GAGCTC 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 295
StyI CCWWGG 2 cut(s) 118, 346
TaqI TCGA 2 cut(s) 285, 417
TasI AATT 2 cut(s) 47, 400
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 1 cut(s) 18
TseI GCWGC 1 cut(s) 79
TspDTI ATGAA 2 cut(s) 126, 293
TspRI CASTG 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 160
XapI RAATTY 2 cut(s) 47, 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.