Prupe.4G164100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
9532002 .. 9534410
2409 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G164100.1

Sequence Viewer

Length: 189 bp
ATGAGTGGAGAAGAATTAGCGGGGCCCCCAGCGCCAAAGCTCCTTCGTCTGCTTTATTTTGTCGGCGCTGGCTTTATTTGCACTGTTGGAATCAACAAATGGCGTGAGCTTCAGCGCAAGTCCATTTTACAACAGCGGCAGCAGCAGCAGCAACAGCTCCCTGAAAATGCCGCAAATGTCCTTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.01

Weight (kDa)

9.1

Isoelectric Point (pI)

76.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017211)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 20, 136, 171
AcuI CTGAAG 1 cut(s) 95
AluBI AGCT 3 cut(s) 40, 109, 157
AluI AGCT 3 cut(s) 40, 109, 157
AoxI GGCC 1 cut(s) 23
ApaI GGGCCC 1 cut(s) 27
ApeKI GCWGC 4 cut(s) 139, 142, 145, 148
AspLEI GCGC 3 cut(s) 34, 68, 117
AspS9I GGNCC 2 cut(s) 23, 24
BaeGI GKGCMC 1 cut(s) 27
BanII GRGCYC 1 cut(s) 27
BbvI GCAGC 4 cut(s) 151, 154, 157, 160
BfoI RGCGCY 2 cut(s) 35, 69
BisI GCNGC 6 cut(s) 137, 140, 143, 146, 149, 171
BlsI GCNGC 6 cut(s) 138, 141, 144, 147, 150, 172
BmgT120I GGNCC 2 cut(s) 23, 24
BmiI GGNNCC 3 cut(s) 24, 25, 26
BseSI GKGCMC 1 cut(s) 27
BseXI GCAGC 4 cut(s) 151, 154, 157, 160
BseYI CCCAGC 1 cut(s) 28
BshFI GGCC 1 cut(s) 25
BsnI GGCC 1 cut(s) 25
Bsp120I GGGCCC 1 cut(s) 23
Bsp1286I GDGCHC 1 cut(s) 27
BspACI CCGC 3 cut(s) 20, 136, 171
BspANI GGCC 1 cut(s) 25
BspLI GGNNCC 3 cut(s) 24, 25, 26
Bst4CI ACNGT 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 70
BstH2I RGCGCY 2 cut(s) 35, 69
BstHHI GCGC 3 cut(s) 34, 68, 117
BstMWI GCNNNNNNNGC 6 cut(s) 31, 78, 142, 145, 148, 154
BstSLI GKGCMC 1 cut(s) 27
BstV1I GCAGC 4 cut(s) 151, 154, 157, 160
BsuRI GGCC 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 70
CfoI GCGC 3 cut(s) 34, 68, 117
Cfr13I GGNCC 2 cut(s) 23, 24
CviJI RGCY 5 cut(s) 25, 40, 72, 109, 157
CviKI_1 RGCY 5 cut(s) 25, 40, 72, 109, 157
Eco24I GRGCYC 1 cut(s) 27
Eco57I CTGAAG 1 cut(s) 95
EcoO109I RGGNCCY 2 cut(s) 23, 24
EcoT38I GRGCYC 1 cut(s) 27
FauI CCCGC 1 cut(s) 13
Fnu4HI GCNGC 6 cut(s) 137, 140, 143, 146, 149, 171
FriOI GRGCYC 1 cut(s) 27
Fsp4HI GCNGC 6 cut(s) 137, 140, 143, 146, 149, 171
GlaI GCGC 3 cut(s) 33, 67, 116
GluI GCNGC 6 cut(s) 137, 140, 143, 146, 149, 171
GsaI CCCAGC 1 cut(s) 32
HaeII RGCGCY 2 cut(s) 35, 69
HaeIII GGCC 1 cut(s) 25
HhaI GCGC 3 cut(s) 34, 68, 117
Hin6I GCGC 3 cut(s) 32, 66, 115
HinP1I GCGC 3 cut(s) 32, 66, 115
HinfI GANTC 1 cut(s) 90
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 81
HpyF10VI GCNNNNNNNGC 6 cut(s) 31, 78, 142, 145, 148, 154
HspAI GCGC 3 cut(s) 32, 66, 115
LmnI GCTCC 2 cut(s) 45, 162
LpnPI CCDG 3 cut(s) 42, 54, 174
Lsp1109I GCAGC 4 cut(s) 151, 154, 157, 160
MboII GAAGA 1 cut(s) 23
MhlI GDGCHC 1 cut(s) 27
MluCI AATT 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 67
MspA1I CMGCKG 1 cut(s) 136
MwoI GCNNNNNNNGC 6 cut(s) 31, 78, 142, 145, 148, 154
NlaIV GGNNCC 3 cut(s) 24, 25, 26
PfeI GAWTC 1 cut(s) 90
PkrI GCNGC 6 cut(s) 138, 141, 144, 147, 150, 172
PspFI CCCAGC 1 cut(s) 28
PspN4I GGNNCC 3 cut(s) 24, 25, 26
PspOMI GGGCCC 1 cut(s) 23
PspPI GGNCC 2 cut(s) 23, 24
SatI GCNGC 6 cut(s) 137, 140, 143, 146, 149, 171
Sau96I GGNCC 2 cut(s) 23, 24
SduI GDGCHC 1 cut(s) 27
SetI ASST 3 cut(s) 42, 111, 159
SgeI CNNG 6 cut(s) 33, 41, 81, 116, 130, 173
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 1 cut(s) 14
SsiI CCGC 3 cut(s) 20, 136, 171
TaaI ACNGT 1 cut(s) 85
TasI AATT 1 cut(s) 14
TauI GCSGC 2 cut(s) 139, 173
TfiI GAWTC 1 cut(s) 90
TscAI CASTG 1 cut(s) 88
TseI GCWGC 4 cut(s) 139, 142, 145, 148
TspRI CASTG 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.