Prupe.5G026600_v2.0.a1

cytochrome c biogenesis

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
3001601 .. 3002376
776 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G026600.1

Sequence Viewer

Length: 222 bp
ATGAACCTTCCGCCCTCATACAAGAGCAGAAGGCCACAGCATTTTCTTCATCGGTGGATGAAGATGGAACAAAGTAACTTCTGGTTGACCATGGTCCCAGAAAAAGAATACAATCGAGAAACGACAAGCATAACTAGAGTAGCCATACATACAAAACTATTCCAGATCTATGTGTCGAATGGAACTCAAAGTTCTAGACTGACTTTGGTGAAAATCGGGTAG

Protein Analysis

74

Amino Acids

8.74

Weight (kDa)

10.43

Isoelectric Point (pI)

65.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018763)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07815 ATMG00180
prunus_persica Prupe.5G026600_v2.0.a1
pyrus_communis pycom12401g00060
rosa_chinensis RchiOBHm_MTg0498431
rosa_laevigata RLG00000000022 RLG00000000465 RLG00000000504
rosa_samantha Rh1BG019000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 94
BccI CCATC 1 cut(s) 58
BfaI CTAG 2 cut(s) 135, 195
BglII AGATCT 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 96
BoxI GACNNNNGTC 1 cut(s) 92
BsaJI CCNNGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 63
BshFI GGCC 1 cut(s) 34
BslFI GGGAC 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 80
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 165
Bsp19I CCATGG 1 cut(s) 90
BspACI CCGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 1 cut(s) 165
BssT1I CCWWGG 1 cut(s) 90
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 63
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BstPAI GACNNNNGTC 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 165
BstYI RGATCY 1 cut(s) 165
BsuRI GGCC 1 cut(s) 34
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 94
CviAII CATG 1 cut(s) 91
CviJI RGCY 2 cut(s) 34, 143
CviKI_1 RGCY 2 cut(s) 34, 143
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 1 cut(s) 94
FaiI YATR 6 cut(s) 19, 92, 131, 146, 150, 171
FaqI GGGAC 1 cut(s) 80
FatI CATG 1 cut(s) 90
FokI GGATG 1 cut(s) 70
FspBI CTAG 2 cut(s) 135, 195
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 1 cut(s) 94
HincII GTYRAC 1 cut(s) 87
HindII GTYRAC 1 cut(s) 87
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 3 cut(s) 116, 163, 195
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 17, 24
Hsp92II CATG 1 cut(s) 94
Kzo9I GATC 1 cut(s) 165
LpnPI CCDG 3 cut(s) 67, 111, 176
MaeI CTAG 2 cut(s) 135, 195
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 2 cut(s) 38, 73
MflI RGATCY 1 cut(s) 165
MnlI CCTC 1 cut(s) 25
NcoI CCATGG 1 cut(s) 90
NdeII GATC 1 cut(s) 165
NlaIII CATG 1 cut(s) 94
NlaIV GGNNCC 1 cut(s) 96
PshAI GACNNNNGTC 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 94
PsuI RGATCY 1 cut(s) 165
Sau3AI GATC 1 cut(s) 165
Sau96I GGNCC 1 cut(s) 94
SetI ASST 1 cut(s) 9
SgeI CNNG 9 cut(s) 34, 94, 103, 110, 128, 138, 147, 175, 207
SinI GGWCC 1 cut(s) 94
SsiI CCGC 1 cut(s) 11
SspMI CTAG 2 cut(s) 135, 195
StyI CCWWGG 1 cut(s) 90
TaqI TCGA 2 cut(s) 115, 176
TspDTI ATGAA 3 cut(s) 17, 38, 74
VpaK11BI GGWCC 1 cut(s) 94
XbaI TCTAGA 1 cut(s) 194
XspI CTAG 2 cut(s) 135, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.