Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp06

Orthogroup ID

OG0019801

Physical Location & Seq

Genomic Coordinates Forward (+)

7214867 .. 7215605

Gene Structure 739 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.6G103200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 624 bp

ATGTCTGCAACTAACAGCTTAGCAGACAGATATCGTATCACTAGTATTCAGGATCTCCTCAGTTTCTTGCTGGGATGCTTCATTTTTTTGGGGTGTATCGGCTTGCCTATTTTTTTTATTTGCCAGGCGATAATGACAAATCCGGAGACATACAAAGTCCCTGAATTCAACGTCACCAATGCTCAGCTCAATCGATTGAATTACACCGAAACCAACCATACTCTCTCTTACAACCTCGCCCTCAACATCACCCTCACAAACCCCAATAAGAAAATCTTATTTAAGTTGACTGACATCCAAGTCATTGCATACCACCAAAACAAGAGATTTGGTCTTGTGACTTTGATGGATAGGCAAACATCGTTTGATCAAAACCCTAAAAGTTCAAGCGTTTTTAATAATGCAGTTATTCAAGGGTGGAAGCCTATGATGTTTGAGGAACCAGTGCTTCCCAATGCTGACCTTTACAATATTGATGTGGTGATTGCTTTCCGAGAAAAAGGTGCTGGATTGTCTGGCCAAGTCATGTGCAATCTGAAGCTTCCATTGAGTTTTAATGGAACATCATGGAATTGTTACAAGACTAGAAAGTGCTCCAAAGTTTTTTATTATCGGGGTTCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576

KEGG Pathways

Metabolic & Signaling

ko00361 ko00364 ko00623 ko01100 ko01110 ko01120 ko01130 map00361 map00364 map00623 map01100 map01110 map01120 map01130

Pfam Domains

Protein Families

DLH

Protein Analysis

208

Amino Acids

23.57

Weight (kDa)

9.14

Isoelectric Point (pI)

22.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019801)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G185400_v2.0.a1 Prupe.1G413200_v2.0.a1 Prupe.6G103200_v2.0.a1
pyrus_communis	pycom05g01680 pycom14g04070 pycom14g04080 pycom14g04090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	299
AccIII	TCCGGA	1 cut(s)	142
AclWI	GGATC	1 cut(s)	60
AcoI	YGGCCR	1 cut(s)	517
AcsI	RAATTY	1 cut(s)	164
AcuI	CTGAAG	1 cut(s)	557
AgsI	TTSAA	4 cut(s)	169, 199, 387, 413
AhlI	ACTAGT	1 cut(s)	41
AjnI	CCWGG	1 cut(s)	123
AluBI	AGCT	3 cut(s)	18, 187, 541
AluI	AGCT	3 cut(s)	18, 187, 541
Alw21I	GWGCWC	1 cut(s)	596
Alw26I	GTCTC	1 cut(s)	140
AlwI	GGATC	1 cut(s)	60
Aor13HI	TCCGGA	1 cut(s)	142
AoxI	GGCC	1 cut(s)	517
ApoI	RAATTY	1 cut(s)	164
AsuHPI	GGTGA	3 cut(s)	166, 241, 493
BalI	TGGCCA	1 cut(s)	519
Bbv12I	GWGCWC	1 cut(s)	596
BccI	CCATC	1 cut(s)	340
BciT130I	CCWGG	1 cut(s)	125
BclI	TGATCA	1 cut(s)	367
BcoDI	GTCTC	1 cut(s)	140
BcuI	ACTAGT	1 cut(s)	41
BfaI	CTAG	2 cut(s)	42, 585
BlpI	GCTNAGC	2 cut(s)	19, 183
Bme1390I	CCNGG	1 cut(s)	125
BmiI	GGNNCC	2 cut(s)	441, 619
BmrFI	CCNGG	1 cut(s)	125
BmsI	GCATC	1 cut(s)	65
Bpu1102I	GCTNAGC	2 cut(s)	19, 183
Bsa29I	ATCGAT	1 cut(s)	193
BsaWI	WCCGGW	1 cut(s)	142
Bse1I	ACTGG	1 cut(s)	443
Bse3DI	GCAATG	1 cut(s)	303
BseAI	TCCGGA	1 cut(s)	142
BseBI	CCWGG	1 cut(s)	125
BseCI	ATCGAT	1 cut(s)	193
BseGI	GGATG	2 cut(s)	80, 294
BseMI	GCAATG	1 cut(s)	303
BseMII	CTCAG	2 cut(s)	73, 197
BseNI	ACTGG	1 cut(s)	443
BseRI	GAGGAG	1 cut(s)	47
BseYI	CCCAGC	1 cut(s)	70
BshFI	GGCC	1 cut(s)	519
BshVI	ATCGAT	1 cut(s)	193
BsiHKAI	GWGCWC	1 cut(s)	596
BsiSI	CCGG	1 cut(s)	143
BslFI	GGGAC	1 cut(s)	143
BsmAI	GTCTC	1 cut(s)	140
BsmFI	GGGAC	1 cut(s)	143
BsnI	GGCC	1 cut(s)	519
Bsp1286I	GDGCHC	1 cut(s)	596
Bsp13I	TCCGGA	1 cut(s)	142
Bsp143I	GATC	2 cut(s)	52, 367
Bsp1720I	GCTNAGC	2 cut(s)	19, 183
BspANI	GGCC	1 cut(s)	519
BspCNI	CTCAG	2 cut(s)	72, 196
BspDI	ATCGAT	1 cut(s)	193
BspEI	TCCGGA	1 cut(s)	142
BspLI	GGNNCC	2 cut(s)	441, 619
BspPI	GGATC	1 cut(s)	60
BsrDI	GCAATG	1 cut(s)	303
BsrI	ACTGG	1 cut(s)	443
BssMI	GATC	2 cut(s)	52, 367
Bst2UI	CCWGG	1 cut(s)	125
BstC8I	GCNNGC	1 cut(s)	104
BstDEI	CTNAG	3 cut(s)	19, 59, 183
BstF5I	GGATG	2 cut(s)	80, 294
BstKTI	GATC	2 cut(s)	55, 370
BstMAI	GTCTC	1 cut(s)	140
BstMBI	GATC	2 cut(s)	52, 367
BstNI	CCWGG	1 cut(s)	125
BstSCI	CCNGG	1 cut(s)	123
BstX2I	RGATCY	1 cut(s)	52
BstYI	RGATCY	1 cut(s)	52
Bsu15I	ATCGAT	1 cut(s)	193
BsuRI	GGCC	1 cut(s)	519
BsuTUI	ATCGAT	1 cut(s)	193
BtsCI	GGATG	2 cut(s)	80, 294
BtsIMutI	CAGTG	1 cut(s)	450
Cac8I	GCNNGC	1 cut(s)	104
ClaI	ATCGAT	1 cut(s)	193
CviAII	CATG	2 cut(s)	526, 567
CviJI	RGCY	6 cut(s)	18, 102, 187, 424, 519, 541
CviKI_1	RGCY	6 cut(s)	18, 102, 187, 424, 519, 541
DdeI	CTNAG	3 cut(s)	19, 59, 183
DpnI	GATC	2 cut(s)	54, 369
DpnII	GATC	2 cut(s)	52, 367
DrdI	GACNNNNNNGTC	1 cut(s)	299
DseDI	GACNNNNNNGTC	1 cut(s)	299
EaeI	YGGCCR	1 cut(s)	517
Eco32I	GATATC	1 cut(s)	32
Eco57I	CTGAAG	1 cut(s)	557
EcoRI	GAATTC	1 cut(s)	164
EcoRII	CCWGG	1 cut(s)	123
EcoRV	GATATC	1 cut(s)	32
FaeI	CATG	2 cut(s)	529, 570
FaiI	YATR	6 cut(s)	151, 219, 310, 428, 527, 568
FalI	AAGNNNNNCTT	2 cut(s)	260, 292
FaqI	GGGAC	1 cut(s)	143
FatI	CATG	2 cut(s)	525, 566
FbaI	TGATCA	1 cut(s)	367
FokI	GGATG	2 cut(s)	87, 281
FspBI	CTAG	2 cut(s)	42, 585
GsaI	CCCAGC	1 cut(s)	74
HaeIII	GGCC	1 cut(s)	519
HapII	CCGG	1 cut(s)	143
Hin1II	CATG	2 cut(s)	529, 570
HincII	GTYRAC	1 cut(s)	288
HindII	GTYRAC	1 cut(s)	288
HindIII	AAGCTT	1 cut(s)	539
HpaII	CCGG	1 cut(s)	143
HphI	GGTGA	3 cut(s)	166, 241, 493
Hpy166II	GTNNAC	1 cut(s)	288
Hpy188I	TCNGA	2 cut(s)	494, 537
Hpy188III	TCNNGA	2 cut(s)	50, 143
Hpy8I	GTNNAC	1 cut(s)	288
HpyCH4IV	ACGT	1 cut(s)	171
HpyCH4V	TGCA	4 cut(s)	8, 308, 404, 531
HpyF3I	CTNAG	3 cut(s)	19, 59, 183
HpySE526I	ACGT	1 cut(s)	171
Hsp92II	CATG	2 cut(s)	529, 570
Kpn2I	TCCGGA	1 cut(s)	142
Ksp22I	TGATCA	1 cut(s)	367
Kzo9I	GATC	2 cut(s)	52, 367
LmnI	GCTCC	1 cut(s)	599
LpnPI	CCDG	9 cut(s)	35, 56, 110, 137, 156, 174, 456, 492, 501
LweI	GCATC	1 cut(s)	65
MaeI	CTAG	2 cut(s)	42, 585
MaeII	ACGT	1 cut(s)	171
MaeIII	GTNAC	3 cut(s)	172, 337, 575
MalI	GATC	2 cut(s)	54, 369
MboI	GATC	2 cut(s)	52, 367
MflI	RGATCY	1 cut(s)	52
MhlI	GDGCHC	1 cut(s)	596
MlsI	TGGCCA	1 cut(s)	519
MluCI	AATT	3 cut(s)	164, 199, 571
MluNI	TGGCCA	1 cut(s)	519
MnlI	CCTC	5 cut(s)	68, 245, 251, 263, 430
Mox20I	TGGCCA	1 cut(s)	519
MroI	TCCGGA	1 cut(s)	142
MscI	TGGCCA	1 cut(s)	519
MseI	TTAA	3 cut(s)	282, 396, 555
Msp20I	TGGCCA	1 cut(s)	519
MspI	CCGG	1 cut(s)	143
MspR9I	CCNGG	1 cut(s)	125
MvaI	CCWGG	1 cut(s)	125
NdeII	GATC	2 cut(s)	52, 367
NlaIII	CATG	2 cut(s)	529, 570
NlaIV	GGNNCC	2 cut(s)	441, 619
NmuCI	GTSAC	2 cut(s)	172, 337
Psp6I	CCWGG	1 cut(s)	123
PspFI	CCCAGC	1 cut(s)	70
PspGI	CCWGG	1 cut(s)	123
PspN4I	GGNNCC	2 cut(s)	441, 619
PsuI	RGATCY	1 cut(s)	52
SaqAI	TTAA	3 cut(s)	282, 396, 555
Sau3AI	GATC	2 cut(s)	52, 367
ScrFI	CCNGG	1 cut(s)	125
SduI	GDGCHC	1 cut(s)	596
SetI	ASST	7 cut(s)	20, 174, 189, 237, 465, 505, 543
SfaNI	GCATC	1 cut(s)	65
SpeI	ACTAGT	1 cut(s)	41
Sse9I	AATT	3 cut(s)	164, 199, 571
SspI	AATATT	1 cut(s)	472
SspMI	CTAG	2 cut(s)	42, 585
StyD4I	CCNGG	1 cut(s)	123
TaiI	ACGT	1 cut(s)	174
TaqI	TCGA	1 cut(s)	193
TasI	AATT	3 cut(s)	164, 199, 571
Tru1I	TTAA	3 cut(s)	282, 396, 555
Tru9I	TTAA	3 cut(s)	282, 396, 555
TscAI	CASTG	1 cut(s)	450
TseFI	GTSAC	2 cut(s)	172, 337
Tsp45I	GTSAC	2 cut(s)	172, 337
TspDTI	ATGAA	1 cut(s)	70
TspRI	CASTG	1 cut(s)	450
XapI	RAATTY	1 cut(s)	164
XspI	CTAG	2 cut(s)	42, 585

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.