Prupe.6G159700_v2.0.a1

IDA-LIKE 2-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
14663092 .. 14664201
1110 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G159700.1

Sequence Viewer

Length: 234 bp
ATGGCTTCAAGTAGACGACCTGTAATTCTACTTGTATGCCTCTTCTTGACGTTCATCTTCACTAATCTCGGCAACTGCCATGCGTCAAGAACCGCCCAAGTCTTCAAGCTCAAGCCGAAGTACCAGCATTCAGGCCACTTTTCGGGGTTCTTGCCAAGAAGGATACCTATTCCGGCTTCTGGACCCTCAAGGAAGCACAATGATATCGGCTTAAGAAGTTGGAGATCACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.72

Weight (kDa)

11.8

Isoelectric Point (pI)

69.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014967)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 13
AciI CCGC 1 cut(s) 93
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 2 cut(s) 142, 179
AflII CTTAAG 1 cut(s) 211
AgsI TTSAA 2 cut(s) 9, 106
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AoxI GGCC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 219
AvaII GGWCC 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 156
BfrI CTTAAG 1 cut(s) 211
BfuI GTATCC 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmiI GGNNCC 1 cut(s) 184
BpiI GAAGAC 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 95, 172
Bsc4I CCNNNNNNNGG 2 cut(s) 142, 179
BseLI CCNNNNNNNGG 2 cut(s) 142, 179
BshFI GGCC 1 cut(s) 135
BsiSI CCGG 1 cut(s) 173
BslI CCNNNNNNNGG 2 cut(s) 142, 179
BsmI GAATGC 1 cut(s) 127
BsnI GGCC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 224
BspACI CCGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 135
BspLI GGNNCC 1 cut(s) 184
BspTI CTTAAG 1 cut(s) 211
BssMI GATC 1 cut(s) 224
Bst6I CTCTTC 1 cut(s) 47
BstAFI CTTAAG 1 cut(s) 211
BstKTI GATC 1 cut(s) 227
BstMBI GATC 1 cut(s) 224
BstV2I GAAGAC 1 cut(s) 94
BsuI GTATCC 1 cut(s) 156
BsuRI GGCC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 182
CseI GACGC 1 cut(s) 72
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 80
CviJI RGCY 6 cut(s) 5, 109, 115, 135, 176, 210
CviKI_1 RGCY 6 cut(s) 5, 109, 115, 135, 176, 210
CviQI GTAC 1 cut(s) 121
DpnI GATC 1 cut(s) 226
DpnII GATC 1 cut(s) 224
Eam1104I CTCTTC 1 cut(s) 47
EarI CTCTTC 1 cut(s) 47
Eco32I GATATC 1 cut(s) 205
Eco47I GGWCC 1 cut(s) 182
EcoRV GATATC 1 cut(s) 205
FaeI CATG 1 cut(s) 83
FaiI YATR 2 cut(s) 37, 81
FatI CATG 1 cut(s) 79
FblI GTMKAC 1 cut(s) 13
HaeIII GGCC 1 cut(s) 135
HapII CCGG 1 cut(s) 173
HgaI GACGC 1 cut(s) 72
Hin1II CATG 1 cut(s) 83
HpaII CCGG 1 cut(s) 173
HphI GGTGA 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 14
Hpy188III TCNNGA 3 cut(s) 46, 87, 180
Hpy8I GTNNAC 1 cut(s) 14
HpyAV CCTTC 1 cut(s) 153
HpyCH4IV ACGT 1 cut(s) 50
HpySE526I ACGT 1 cut(s) 50
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 1 cut(s) 224
LpnPI CCDG 5 cut(s) 33, 117, 137, 165, 186
MaeII ACGT 1 cut(s) 50
MalI GATC 1 cut(s) 226
MboI GATC 1 cut(s) 224
MboII GAAGA 3 cut(s) 34, 49, 94
MluCI AATT 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 2 cut(s) 50, 196
MseI TTAA 1 cut(s) 212
MspCI CTTAAG 1 cut(s) 211
MspI CCGG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 127
NdeII GATC 1 cut(s) 224
NlaIII CATG 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 184
NmeAIII GCCGAG 1 cut(s) 48
PctI GAATGC 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 184
PspPI GGNCC 1 cut(s) 182
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 1 cut(s) 212
Sau3AI GATC 1 cut(s) 224
Sau96I GGNCC 1 cut(s) 182
SetI ASST 4 cut(s) 22, 53, 111, 169
SinI GGWCC 1 cut(s) 182
SmlI CTYRAG 3 cut(s) 110, 187, 211
SmoI CTYRAG 3 cut(s) 110, 187, 211
Sse9I AATT 1 cut(s) 24
SsiI CCGC 1 cut(s) 93
TaiI ACGT 1 cut(s) 53
TasI AATT 1 cut(s) 24
Tru1I TTAA 1 cut(s) 212
Tru9I TTAA 1 cut(s) 212
TspDTI ATGAA 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 211
VpaK11BI GGWCC 1 cut(s) 182
XmiI GTMKAC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.