Prupe.6G311200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0013695
Physical Location & Seq
Reverse (-)
27880639 .. 27883523
2885 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G311200.3

Sequence Viewer

Length: 567 bp
ATGGATCATCTAGGTTCTAAGGAAAGTGATCTGGATTTTGACTTGGAAAGTGGTGAGACTGAAAGCACCAGTGAAGAAGATGGAAATGAAAGGTCGGGTTCAGATGGTAAATGTTCCAGGAAAACAATGGCTAGGGCAAGGAGTGGGTACTTGTATGTTGATGGATCAATCGCAGCTAGTGATGGGCTAAGTGCAGGCAATAATGTATCAAGTATTGGTCAGAATATGGATATGTTAGCTAGTAGTATGGGGCAAATGGCAGAAGGAAGAACGGAGAAGAGGACAGTCGAGAAACAGAAAAAGATCCCTAAAAAGCATCCCAAGCCACCTCGGCCTCCTACAGGTCCATCATTACATGCCGCCGATATAGAGTTCGTCAAAGAAATTTCAAAGCGTTCAAGGTTGCGGCGTGCAAGGAGAGAAAGGATGAATGCATTGAAGAAAATGAAATCTGATAAAACATCATCATCGAAGATAAACTTCTTGGCAATGATTGTCACCACTATCTTCTGCTTTGTGATAATCTTCCACGTTTGGCCGCCGAATGCCATGGGGATTGATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

189

Amino Acids

20.83

Weight (kDa)

9.34

Isoelectric Point (pI)

46.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013695)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g07660 FvH4_6g07660
malus_domestica MD12G1204500.v1.1
prunus_persica Prupe.6G311200_v2.0.a1 Prupe.6G311200_v2.0.a1 Prupe.6G311200_v2.0.a1
pyrus_communis pycom12g19190
rosa_chinensis RchiOBHm_Chr3g0457351
rosa_laevigata RLG00000025233
rosa_multiflora Rmu_sc0005442.1_g000009
rosa_roxburghii Rroxscaffold_6G00421960
rosa_rugosa Rorug03G0019900 Rorug03G0020000
rosa_samantha Rh3AG080200 Rh3BG082000 Rh3CG082300 Rh3DG083700
rosa_wichuraiana Rw3G006900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 360, 406, 539
AclWI GGATC 3 cut(s) 12, 172, 298
AcoI YGGCCR 1 cut(s) 536
AcsI RAATTY 1 cut(s) 384
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 341
AgsI TTSAA 3 cut(s) 390, 399, 439
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 2 cut(s) 176, 239
AluI AGCT 2 cut(s) 176, 239
Alw26I GTCTC 1 cut(s) 50
AlwI GGATC 3 cut(s) 12, 172, 298
AoxI GGCC 2 cut(s) 332, 536
ApeKI GCWGC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 384
AspS9I GGNCC 1 cut(s) 344
AsuHPI GGTGA 2 cut(s) 65, 490
AvaII GGWCC 1 cut(s) 344
BbvI GCAGC 1 cut(s) 185
BccI CCATC 5 cut(s) 74, 98, 155, 176, 355
BciT130I CCWGG 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 50
BfaI CTAG 4 cut(s) 11, 132, 177, 240
BfmI CTRYAG 1 cut(s) 339
BglI GCCNNNNNGGC 1 cut(s) 331
BisI GCNGC 4 cut(s) 174, 360, 407, 539
BlsI GCNGC 4 cut(s) 175, 361, 408, 540
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 344
BmgT120I GGNCC 1 cut(s) 344
BmrFI CCNGG 1 cut(s) 118
BmsI GCATC 1 cut(s) 325
BsaJI CCNNGG 2 cut(s) 329, 549
Bsc4I CCNNNNNNNGG 1 cut(s) 341
Bse1I ACTGG 1 cut(s) 69
Bse3DI GCAATG 1 cut(s) 495
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 2 cut(s) 329, 549
BseGI GGATG 2 cut(s) 316, 432
BseLI CCNNNNNNNGG 1 cut(s) 341
BseMI GCAATG 1 cut(s) 495
BseNI ACTGG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 185
BsgI GTGCAG 1 cut(s) 213
BshFI GGCC 2 cut(s) 334, 538
BslI CCNNNNNNNGG 1 cut(s) 341
BsmAI GTCTC 1 cut(s) 50
BsmI GAATGC 2 cut(s) 436, 550
BsnI GGCC 2 cut(s) 334, 538
Bsp143I GATC 4 cut(s) 4, 28, 164, 303
Bsp19I CCATGG 1 cut(s) 549
BspACI CCGC 3 cut(s) 360, 406, 539
BspANI GGCC 2 cut(s) 334, 538
BspPI GGATC 3 cut(s) 12, 172, 298
BsrDI GCAATG 1 cut(s) 495
BsrI ACTGG 1 cut(s) 69
BssECI CCNNGG 2 cut(s) 329, 549
BssMI GATC 4 cut(s) 4, 28, 164, 303
BssT1I CCWWGG 1 cut(s) 549
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 1 cut(s) 286
Bst6I CTCTTC 1 cut(s) 272
BstC8I GCNNGC 2 cut(s) 196, 411
BstDEI CTNAG 2 cut(s) 18, 188
BstDSI CCRYGG 1 cut(s) 549
BstENI CCTNNNNNAGG 1 cut(s) 339
BstF5I GGATG 2 cut(s) 316, 432
BstKTI GATC 4 cut(s) 7, 31, 167, 306
BstMAI GTCTC 1 cut(s) 50
BstMBI GATC 4 cut(s) 4, 28, 164, 303
BstMWI GCNNNNNNNGC 2 cut(s) 322, 331
BstNI CCWGG 1 cut(s) 118
BstNSI RCATGY 1 cut(s) 359
BstSCI CCNGG 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 339
BstV1I GCAGC 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 303
BstYI RGATCY 1 cut(s) 303
BsuRI GGCC 2 cut(s) 334, 538
BtgI CCRYGG 1 cut(s) 549
BtsCI GGATG 2 cut(s) 316, 432
BtsIMutI CAGTG 1 cut(s) 76
Cac8I GCNNGC 2 cut(s) 196, 411
Cfr13I GGNCC 1 cut(s) 344
Csp6I GTAC 1 cut(s) 148
CviAII CATG 2 cut(s) 356, 550
CviJI RGCY 7 cut(s) 131, 176, 187, 239, 325, 334, 538
CviKI_1 RGCY 7 cut(s) 131, 176, 187, 239, 325, 334, 538
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 2 cut(s) 18, 188
DpnI GATC 4 cut(s) 6, 30, 166, 305
DpnII GATC 4 cut(s) 4, 28, 164, 303
EaeI YGGCCR 1 cut(s) 536
Eam1104I CTCTTC 1 cut(s) 272
EarI CTCTTC 1 cut(s) 272
Eco130I CCWWGG 1 cut(s) 549
Eco47I GGWCC 1 cut(s) 344
EcoNI CCTNNNNNAGG 1 cut(s) 339
EcoRII CCWGG 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 549
EcoT22I ATGCAT 1 cut(s) 436
ErhI CCWWGG 1 cut(s) 549
FaeI CATG 2 cut(s) 359, 553
FaiI YATR 7 cut(s) 156, 227, 233, 248, 357, 368, 551
FalI AAGNNNNNCTT 2 cut(s) 464, 496
FatI CATG 2 cut(s) 355, 549
Fnu4HI GCNGC 4 cut(s) 174, 360, 407, 539
FokI GGATG 2 cut(s) 303, 439
Fsp4HI GCNGC 4 cut(s) 174, 360, 407, 539
FspBI CTAG 4 cut(s) 11, 132, 177, 240
GluI GCNGC 4 cut(s) 174, 360, 407, 539
HaeIII GGCC 2 cut(s) 334, 538
Hin1II CATG 2 cut(s) 359, 553
HphI GGTGA 2 cut(s) 65, 490
Hpy188I TCNGA 3 cut(s) 103, 222, 454
Hpy188III TCNNGA 2 cut(s) 32, 289
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4IV ACGT 1 cut(s) 531
HpyCH4V TGCA 3 cut(s) 194, 413, 434
HpyF10VI GCNNNNNNNGC 2 cut(s) 322, 331
HpyF3I CTNAG 2 cut(s) 18, 188
HpySE526I ACGT 1 cut(s) 531
Hsp92II CATG 2 cut(s) 359, 553
Kzo9I GATC 4 cut(s) 4, 28, 164, 303
LpnPI CCDG 6 cut(s) 17, 82, 103, 130, 180, 327
Lsp1109I GCAGC 1 cut(s) 185
LweI GCATC 1 cut(s) 325
MaeI CTAG 4 cut(s) 11, 132, 177, 240
MaeII ACGT 1 cut(s) 531
MaeIII GTNAC 1 cut(s) 496
MalI GATC 4 cut(s) 6, 30, 166, 305
MboI GATC 4 cut(s) 4, 28, 164, 303
MboII GAAGA 8 cut(s) 86, 89, 279, 289, 451, 484, 499, 517
MflI RGATCY 1 cut(s) 303
MluCI AATT 1 cut(s) 384
MnlI CCTC 3 cut(s) 273, 339, 345
Mph1103I ATGCAT 1 cut(s) 436
MspR9I CCNGG 1 cut(s) 118
Mva1269I GAATGC 2 cut(s) 436, 550
MvaI CCWGG 1 cut(s) 118
MwoI GCNNNNNNNGC 2 cut(s) 322, 331
NcoI CCATGG 1 cut(s) 549
NdeII GATC 4 cut(s) 4, 28, 164, 303
NlaIII CATG 2 cut(s) 359, 553
NmeAIII GCCGAG 1 cut(s) 310
NmuCI GTSAC 1 cut(s) 496
NsiI ATGCAT 1 cut(s) 436
NspI RCATGY 1 cut(s) 359
PctI GAATGC 2 cut(s) 436, 550
PfoI TCCNGGA 1 cut(s) 116
PkrI GCNGC 4 cut(s) 175, 361, 408, 540
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspPI GGNCC 1 cut(s) 344
PsuI RGATCY 1 cut(s) 303
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SatI GCNGC 4 cut(s) 174, 360, 407, 539
Sau3AI GATC 4 cut(s) 4, 28, 164, 303
Sau96I GGNCC 1 cut(s) 344
ScrFI CCNGG 1 cut(s) 118
SetI ASST 8 cut(s) 16, 95, 178, 241, 331, 346, 404, 534
SfaNI GCATC 1 cut(s) 325
SfcI CTRYAG 1 cut(s) 339
SinI GGWCC 1 cut(s) 344
Sse9I AATT 1 cut(s) 384
SsiI CCGC 3 cut(s) 360, 406, 539
SspMI CTAG 4 cut(s) 11, 132, 177, 240
StyD4I CCNGG 1 cut(s) 116
StyI CCWWGG 1 cut(s) 549
TaaI ACNGT 1 cut(s) 286
TaiI ACGT 1 cut(s) 534
TaqI TCGA 2 cut(s) 288, 470
TasI AATT 1 cut(s) 384
TauI GCSGC 3 cut(s) 362, 409, 541
TscAI CASTG 1 cut(s) 76
TseFI GTSAC 1 cut(s) 496
TseI GCWGC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 496
TspDTI ATGAA 3 cut(s) 102, 443, 461
TspGWI ACGGA 1 cut(s) 287
TspRI CASTG 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 344
XagI CCTNNNNNAGG 1 cut(s) 339
XapI RAATTY 1 cut(s) 384
XceI RCATGY 1 cut(s) 359
XcmI CCANNNNNNNNNTGG 1 cut(s) 124
XspI CTAG 4 cut(s) 11, 132, 177, 240
Zsp2I ATGCAT 1 cut(s) 436
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.