Prupe.8G049400_v2.0.a1

Required for replication-independent chromatin assembly and for the periodic repression of histone gene transcription during the cell cycle

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Forward (+)
5378139 .. 5379776
1638 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G049400.1

Sequence Viewer

Length: 150 bp
ATGATTGCAGAAAAGCCCAGTTGGATTAGGCACGAGGGAATGCAAATTTTCTCCATTGATGTTCAGCCTGGTGGACTTAGGCTGGCCACTGGTGGGGGTGACCACAAGGTGCGACTTCTCTCCTCCTTTGTGCTCTGTTTGCTTGCTTAG

Protein Analysis

50

Amino Acids

5.35

Weight (kDa)

8.0

Isoelectric Point (pI)

39.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017268)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 84
AcsI RAATTY 1 cut(s) 45
AdeI CACNNNGTG 1 cut(s) 109
AfiI CCNNNNNNNGG 1 cut(s) 93
AjnI CCWGG 1 cut(s) 67
Alw21I GWGCWC 1 cut(s) 135
AoxI GGCC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 110
BalI TGGCCA 1 cut(s) 86
BauI CACGAG 1 cut(s) 32
Bbv12I GWGCWC 1 cut(s) 135
BciT130I CCWGG 1 cut(s) 69
Bme1390I CCNGG 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 69
BmrI ACTGGG 1 cut(s) 12
BmuI ACTGGG 1 cut(s) 12
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 2 cut(s) 18, 94
BseBI CCWGG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 2 cut(s) 18, 94
BseRI GAGGAG 1 cut(s) 112
BshFI GGCC 1 cut(s) 86
BsiHKAI GWGCWC 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 93
BsmI GAATGC 1 cut(s) 45
BsnI GGCC 1 cut(s) 86
Bsp1286I GDGCHC 1 cut(s) 135
BspANI GGCC 1 cut(s) 86
BsrI ACTGG 2 cut(s) 18, 94
BssSI CACGAG 1 cut(s) 32
Bst2BI CACGAG 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 69
BstC8I GCNNGC 2 cut(s) 84, 144
BstDEI CTNAG 2 cut(s) 77, 147
BstEII GGTNACC 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 69
BstPI GGTNACC 1 cut(s) 98
BstSCI CCNGG 1 cut(s) 67
BsuRI GGCC 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 87
Cac8I GCNNGC 2 cut(s) 84, 144
CviJI RGCY 4 cut(s) 16, 67, 82, 86
CviKI_1 RGCY 4 cut(s) 16, 67, 82, 86
DdeI CTNAG 2 cut(s) 77, 147
DraIII CACNNNGTG 1 cut(s) 109
EaeI YGGCCR 1 cut(s) 84
Eco91I GGTNACC 1 cut(s) 98
EcoO65I GGTNACC 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 67
HaeIII GGCC 1 cut(s) 86
HphI GGTGA 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 8, 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
HpyF3I CTNAG 2 cut(s) 77, 147
LpnPI CCDG 5 cut(s) 31, 54, 68, 75, 81
MaeIII GTNAC 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 135
MlsI TGGCCA 1 cut(s) 86
MluCI AATT 1 cut(s) 45
MluNI TGGCCA 1 cut(s) 86
MnlI CCTC 2 cut(s) 28, 133
Mox20I TGGCCA 1 cut(s) 86
MscI TGGCCA 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 69
Mva1269I GAATGC 1 cut(s) 45
MvaI CCWGG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 98
PctI GAATGC 1 cut(s) 45
Psp6I CCWGG 1 cut(s) 67
PspEI GGTNACC 1 cut(s) 98
PspGI CCWGG 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 69
SduI GDGCHC 1 cut(s) 135
SetI ASST 1 cut(s) 111
SgeI CNNG 8 cut(s) 30, 44, 46, 80, 81, 95, 102, 118
Sse9I AATT 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 67
TasI AATT 1 cut(s) 45
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspRI CASTG 1 cut(s) 94
XapI RAATTY 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.