Rmu_sc0002922.1_g000015

Required for replication-independent chromatin assembly and for the periodic repression of histone gene transcription during the cell cycle

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002922.1
Physical Location & Seq
Forward (+)
52401 .. 53958
1558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002922.1_g000015.1.cds

Sequence Viewer

Length: 435 bp
atgattgcagaaaagcccagttggattaggcatgagggtttgcaaattttctccattgatgttcagcctggtggacttagggttgccactggtgggggtgaccacaaggtgcgggtatggaacatgaaatccctgggcagggatttctcaaatgaagaatcagccgaaaggctacttgcaaccctccgtgatcactttggttctgtgaattgtgttagatgggcaaagcatggtcgctatcttgcatcaggatctgatgatcaagtaattctaattcatgagaggaagccaggttcaggaaccactgagtttggcagtggagagccccctgatgtcgagaattggaaagttgcaatgactttgagagggcatactgcagatatgtgctgcttttctgtggttaaagtaggtggatctcaattggtctccagatga

Protein Analysis

144

Amino Acids

15.85

Weight (kDa)

7.8

Isoelectric Point (pI)

29.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017268)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 112
AclWI GGATC 2 cut(s) 259, 421
AcsI RAATTY 1 cut(s) 45
AdeI CACNNNGTG 1 cut(s) 109
AfiI CCNNNNNNNGG 4 cut(s) 93, 138, 139, 296
AjnI CCWGG 3 cut(s) 67, 132, 289
AloI GAACNNNNNNTCC 4 cut(s) 113, 145, 277, 309
Alw26I GTCTC 1 cut(s) 430
AlwI GGATC 2 cut(s) 259, 421
AlwNI CAGNNNCTG 1 cut(s) 254
ApeKI GCWGC 1 cut(s) 387
ApoI RAATTY 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 110
BanII GRGCYC 1 cut(s) 327
BbvI GCAGC 1 cut(s) 374
BccI CCATC 1 cut(s) 213
BciT130I CCWGG 3 cut(s) 69, 134, 291
BclI TGATCA 2 cut(s) 190, 259
BcoDI GTCTC 1 cut(s) 430
BfmI CTRYAG 1 cut(s) 375
BisI GCNGC 1 cut(s) 388
BlsI GCNGC 1 cut(s) 389
Bme1390I CCNGG 3 cut(s) 69, 134, 291
BmiI GGNNCC 1 cut(s) 301
BmrFI CCNGG 3 cut(s) 69, 134, 291
BmrI ACTGGG 1 cut(s) 12
BmsI GCATC 1 cut(s) 254
BmuI ACTGGG 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 412
BsaI GGTCTC 1 cut(s) 430
BsaJI CCNNGG 2 cut(s) 132, 133
Bsc4I CCNNNNNNNGG 4 cut(s) 93, 138, 139, 296
Bse1I ACTGG 2 cut(s) 18, 94
Bse3DI GCAATG 1 cut(s) 360
BseBI CCWGG 3 cut(s) 69, 134, 291
BseDI CCNNGG 2 cut(s) 132, 133
BseLI CCNNNNNNNGG 4 cut(s) 93, 138, 139, 296
BseMI GCAATG 1 cut(s) 360
BseMII CTCAG 1 cut(s) 297
BseNI ACTGG 2 cut(s) 18, 94
BseXI GCAGC 1 cut(s) 374
BslI CCNNNNNNNGG 4 cut(s) 93, 138, 139, 296
BsmAI GTCTC 1 cut(s) 430
Bso31I GGTCTC 1 cut(s) 430
Bsp1286I GDGCHC 1 cut(s) 327
Bsp143I GATC 4 cut(s) 190, 251, 259, 413
BspACI CCGC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 298
BspHI TCATGA 1 cut(s) 277
BspLI GGNNCC 1 cut(s) 301
BspMAI CTGCAG 1 cut(s) 379
BspPI GGATC 2 cut(s) 259, 421
BspTNI GGTCTC 1 cut(s) 430
BsrDI GCAATG 1 cut(s) 360
BsrI ACTGG 2 cut(s) 18, 94
BssECI CCNNGG 2 cut(s) 132, 133
BssMI GATC 4 cut(s) 190, 251, 259, 413
Bst2UI CCWGG 3 cut(s) 69, 134, 291
BstDEI CTNAG 2 cut(s) 77, 306
BstEII GGTNACC 1 cut(s) 98
BstKTI GATC 4 cut(s) 193, 254, 262, 416
BstMAI GTCTC 1 cut(s) 430
BstMBI GATC 4 cut(s) 190, 251, 259, 413
BstNI CCWGG 3 cut(s) 69, 134, 291
BstPI GGTNACC 1 cut(s) 98
BstSCI CCNGG 3 cut(s) 67, 132, 289
BstSFI CTRYAG 1 cut(s) 375
BstV1I GCAGC 1 cut(s) 374
BstX2I RGATCY 2 cut(s) 251, 413
BstYI RGATCY 2 cut(s) 251, 413
BtsI GCAGTG 1 cut(s) 322
BtsIMutI CAGTG 3 cut(s) 87, 303, 322
CaiI CAGNNNCTG 1 cut(s) 254
CciI TCATGA 1 cut(s) 277
CspCI CAANNNNNGTGG 2 cut(s) 292, 327
CviAII CATG 4 cut(s) 32, 124, 230, 278
CviJI RGCY 6 cut(s) 16, 67, 164, 172, 289, 325
CviKI_1 RGCY 6 cut(s) 16, 67, 164, 172, 289, 325
DdeI CTNAG 2 cut(s) 77, 306
DpnI GATC 4 cut(s) 192, 253, 261, 415
DpnII GATC 4 cut(s) 190, 251, 259, 413
DraIII CACNNNGTG 1 cut(s) 109
Eco24I GRGCYC 1 cut(s) 327
Eco31I GGTCTC 1 cut(s) 430
Eco91I GGTNACC 1 cut(s) 98
EcoO65I GGTNACC 1 cut(s) 98
EcoRII CCWGG 3 cut(s) 67, 132, 289
EcoT38I GRGCYC 1 cut(s) 327
FaeI CATG 4 cut(s) 35, 127, 233, 281
FaiI YATR 7 cut(s) 33, 118, 125, 231, 279, 372, 383
FatI CATG 4 cut(s) 31, 123, 229, 277
FauI CCCGC 1 cut(s) 105
FbaI TGATCA 2 cut(s) 190, 259
Fnu4HI GCNGC 1 cut(s) 388
FriOI GRGCYC 1 cut(s) 327
Fsp4HI GCNGC 1 cut(s) 388
GluI GCNGC 1 cut(s) 388
GsuI CTGGAG 1 cut(s) 412
Hin1II CATG 4 cut(s) 35, 127, 233, 281
HinfI GANTC 1 cut(s) 158
HphI GGTGA 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 5 cut(s) 249, 278, 297, 337, 429
Hpy8I GTNNAC 1 cut(s) 74
HpyCH4V TGCA 6 cut(s) 8, 43, 179, 245, 353, 377
HpyF3I CTNAG 2 cut(s) 77, 306
Hsp92II CATG 4 cut(s) 35, 127, 233, 281
Ksp22I TGATCA 2 cut(s) 190, 259
Kzo9I GATC 4 cut(s) 190, 251, 259, 413
Lsp1109I GCAGC 1 cut(s) 374
LweI GCATC 1 cut(s) 254
MaeIII GTNAC 1 cut(s) 98
MalI GATC 4 cut(s) 192, 253, 261, 415
MboI GATC 4 cut(s) 190, 251, 259, 413
MboII GAAGA 1 cut(s) 167
MfeI CAATTG 1 cut(s) 419
MflI RGATCY 2 cut(s) 251, 413
MhlI GDGCHC 1 cut(s) 327
MluCI AATT 6 cut(s) 45, 208, 267, 273, 340, 419
MnlI CCTC 4 cut(s) 28, 194, 276, 359
MseI TTAA 1 cut(s) 402
MspR9I CCNGG 3 cut(s) 69, 134, 291
MunI CAATTG 1 cut(s) 419
MvaI CCWGG 3 cut(s) 69, 134, 291
NdeII GATC 4 cut(s) 190, 251, 259, 413
NlaIII CATG 4 cut(s) 35, 127, 233, 281
NlaIV GGNNCC 1 cut(s) 301
NmuCI GTSAC 1 cut(s) 98
PagI TCATGA 1 cut(s) 277
PasI CCCWGGG 1 cut(s) 133
PfeI GAWTC 1 cut(s) 158
PkrI GCNGC 1 cut(s) 389
Psp6I CCWGG 3 cut(s) 67, 132, 289
PspEI GGTNACC 1 cut(s) 98
PspGI CCWGG 3 cut(s) 67, 132, 289
PspN4I GGNNCC 1 cut(s) 301
PstI CTGCAG 1 cut(s) 379
PstNI CAGNNNCTG 1 cut(s) 254
PsuI RGATCY 2 cut(s) 251, 413
SaqAI TTAA 1 cut(s) 402
SatI GCNGC 1 cut(s) 388
Sau3AI GATC 4 cut(s) 190, 251, 259, 413
ScrFI CCNGG 3 cut(s) 69, 134, 291
SduI GDGCHC 1 cut(s) 327
SetI ASST 3 cut(s) 111, 295, 412
SfaNI GCATC 1 cut(s) 254
SfcI CTRYAG 1 cut(s) 375
Sse9I AATT 6 cut(s) 45, 208, 267, 273, 340, 419
SsiI CCGC 1 cut(s) 112
StyD4I CCNGG 3 cut(s) 67, 132, 289
TaqI TCGA 1 cut(s) 336
TasI AATT 6 cut(s) 45, 208, 267, 273, 340, 419
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 402
Tru9I TTAA 1 cut(s) 402
TscAI CASTG 3 cut(s) 94, 310, 322
TseFI GTSAC 1 cut(s) 98
TseI GCWGC 1 cut(s) 387
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 3 cut(s) 140, 168, 266
TspGWI ACGGA 1 cut(s) 176
TspRI CASTG 3 cut(s) 94, 310, 322
XapI RAATTY 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.