Prupe.8G103200_v2.0.a1

Pfam:DUF3633

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0016790
Physical Location & Seq
Reverse (-)
13432021 .. 13432909
889 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G103200.1

Sequence Viewer

Length: 342 bp
ATGACCGGTGCAATCTTGGCTCATGAGATGATGCATGCATGGTTTCGACTAAGAGGTATTAGAACAGGCCAACTGGAACTAAAAGTGGAAGAAGGAATGTGCCAAGTGATAGGTCGAAAATGGTTGGAGTGGTTGGAGGCCCAGGATCGCAAGACCTCATCAGCGATTACAGAGCATGCTCAGTTTCAGAGAAACCTAATTGAAACGTACAAGTATGTGGTGGATATGCATTCCTCTTACGAGTATGGCCATGGATTTCGAGAAGCTAAATGGGCAGTTGAAAAATATAAACTTCACAGAACAATCGATCACATTTTAACTTATAGAAAACTTCCAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DA1-like

Protein Analysis

114

Amino Acids

13.52

Weight (kDa)

8.71

Isoelectric Point (pI)

29.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016790)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g21570
prunus_persica Prupe.8G103200_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0037021
rosa_laevigata RLG00000024635 RLG00000033744
rosa_multiflora Rmu_co8219504.1_g000001 Rmu_sc0008296.1_g000003 Rmu_ssc0000062.1_g000041
rosa_roxburghii Rroxscaffold_1G00043920
rosa_samantha Rh5AG251900 Rh5BG253500 Rh5CG286200 Rh5DG262100
rosa_wichuraiana Rw5G023210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 247
AfaI GTAC 1 cut(s) 209
AgeI ACCGGT 1 cut(s) 5
AgsI TTSAA 2 cut(s) 203, 281
AjnI CCWGG 1 cut(s) 141
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
AlwI GGATC 1 cut(s) 153
AoxI GGCC 3 cut(s) 67, 138, 247
AsiGI ACCGGT 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 139
BalI TGGCCA 1 cut(s) 249
BciT130I CCWGG 1 cut(s) 143
Bme1390I CCNGG 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 143
BmsI GCATC 1 cut(s) 21
Bsa29I ATCGAT 1 cut(s) 306
BsaJI CCNNGG 2 cut(s) 141, 250
BsaWI WCCGGW 1 cut(s) 5
Bse118I RCCGGY 1 cut(s) 5
Bse1I ACTGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 143
BseCI ATCGAT 1 cut(s) 306
BseDI CCNNGG 2 cut(s) 141, 250
BseMII CTCAG 1 cut(s) 194
BseNI ACTGG 1 cut(s) 78
BshFI GGCC 3 cut(s) 69, 140, 249
BshTI ACCGGT 1 cut(s) 5
BshVI ATCGAT 1 cut(s) 306
BsiSI CCGG 1 cut(s) 6
BsmI GAATGC 1 cut(s) 229
BsnI GGCC 3 cut(s) 69, 140, 249
Bsp143I GATC 2 cut(s) 145, 307
Bsp19I CCATGG 1 cut(s) 250
BspANI GGCC 3 cut(s) 69, 140, 249
BspCNI CTCAG 1 cut(s) 193
BspDI ATCGAT 1 cut(s) 306
BspHI TCATGA 1 cut(s) 22
BspPI GGATC 1 cut(s) 153
BsrFI RCCGGY 1 cut(s) 5
BsrI ACTGG 1 cut(s) 78
BssAI RCCGGY 1 cut(s) 5
BssECI CCNNGG 2 cut(s) 141, 250
BssMI GATC 2 cut(s) 145, 307
BssT1I CCWWGG 1 cut(s) 250
Bst2UI CCWGG 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 36, 177
BstDEI CTNAG 2 cut(s) 50, 180
BstDSI CCRYGG 1 cut(s) 250
BstKTI GATC 2 cut(s) 148, 310
BstMBI GATC 2 cut(s) 145, 307
BstMWI GCNNNNNNNGC 2 cut(s) 17, 272
BstNI CCWGG 1 cut(s) 143
BstNSI RCATGY 2 cut(s) 38, 179
BstSCI CCNGG 1 cut(s) 141
Bsu15I ATCGAT 1 cut(s) 306
BsuRI GGCC 3 cut(s) 69, 140, 249
BsuTUI ATCGAT 1 cut(s) 306
BtgI CCRYGG 1 cut(s) 250
Cac8I GCNNGC 2 cut(s) 36, 177
CciI TCATGA 1 cut(s) 22
Cfr10I RCCGGY 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 139
ClaI ATCGAT 1 cut(s) 306
Csp6I GTAC 1 cut(s) 208
CspAI ACCGGT 1 cut(s) 5
CviAII CATG 5 cut(s) 23, 35, 39, 176, 251
CviJI RGCY 5 cut(s) 20, 69, 140, 249, 266
CviKI_1 RGCY 5 cut(s) 20, 69, 140, 249, 266
CviQI GTAC 1 cut(s) 208
DdeI CTNAG 2 cut(s) 50, 180
DpnI GATC 2 cut(s) 147, 309
DpnII GATC 2 cut(s) 145, 307
EaeI YGGCCR 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 250
EcoT22I ATGCAT 3 cut(s) 36, 40, 231
ErhI CCWWGG 1 cut(s) 250
FaeI CATG 5 cut(s) 26, 38, 42, 179, 254
FatI CATG 5 cut(s) 22, 34, 38, 175, 250
HaeIII GGCC 3 cut(s) 69, 140, 249
HapII CCGG 1 cut(s) 6
Hin1II CATG 5 cut(s) 26, 38, 42, 179, 254
HpaII CCGG 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 3 cut(s) 23, 260, 335
HpyAV CCTTC 1 cut(s) 86
HpyCH4IV ACGT 1 cut(s) 206
HpyCH4V TGCA 4 cut(s) 11, 34, 38, 229
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 272
HpyF3I CTNAG 2 cut(s) 50, 180
HpySE526I ACGT 1 cut(s) 206
Hsp92II CATG 5 cut(s) 26, 38, 42, 179, 254
Kzo9I GATC 2 cut(s) 145, 307
LpnPI CCDG 5 cut(s) 19, 51, 59, 128, 155
LweI GCATC 1 cut(s) 21
MaeII ACGT 1 cut(s) 206
MalI GATC 2 cut(s) 147, 309
MboI GATC 2 cut(s) 145, 307
MboII GAAGA 1 cut(s) 101
MlsI TGGCCA 1 cut(s) 249
MluCI AATT 1 cut(s) 198
MluNI TGGCCA 1 cut(s) 249
MmeI TCCRAC 2 cut(s) 105, 114
MnlI CCTC 4 cut(s) 47, 130, 166, 244
Mox20I TGGCCA 1 cut(s) 249
Mph1103I ATGCAT 3 cut(s) 36, 40, 231
MscI TGGCCA 1 cut(s) 249
MseI TTAA 1 cut(s) 317
Msp20I TGGCCA 1 cut(s) 249
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 143
Mva1269I GAATGC 1 cut(s) 229
MvaI CCWGG 1 cut(s) 143
MwoI GCNNNNNNNGC 2 cut(s) 17, 272
NcoI CCATGG 1 cut(s) 250
NdeII GATC 2 cut(s) 145, 307
NlaIII CATG 5 cut(s) 26, 38, 42, 179, 254
NsiI ATGCAT 3 cut(s) 36, 40, 231
NspI RCATGY 2 cut(s) 38, 179
PaeI GCATGC 2 cut(s) 38, 179
PagI TCATGA 1 cut(s) 22
PctI GAATGC 1 cut(s) 229
PinAI ACCGGT 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PspPI GGNCC 1 cut(s) 139
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SaqAI TTAA 1 cut(s) 317
Sau3AI GATC 2 cut(s) 145, 307
Sau96I GGNCC 1 cut(s) 139
ScrFI CCNGG 1 cut(s) 143
SetI ASST 6 cut(s) 58, 115, 158, 198, 209, 268
SfaNI GCATC 1 cut(s) 21
SphI GCATGC 2 cut(s) 38, 179
Sse9I AATT 1 cut(s) 198
StyD4I CCNGG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 250
TaiI ACGT 1 cut(s) 209
TaqI TCGA 4 cut(s) 46, 115, 259, 306
TasI AATT 1 cut(s) 198
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
XceI RCATGY 2 cut(s) 38, 179
Zsp2I ATGCAT 3 cut(s) 36, 40, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.