pycom01g01500

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
1393961 .. 1394221
261 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g01500.1

Sequence Viewer

Length: 261 bp
ATGGAGGATGGGAATCTGCCAATGCCATTGGTTTCCAAGGCCAAAACCAACCCAAATATGATCCGTACTCCAACACCTACAACCCCGGGTGGAGAGATCACCCTAATTTCAAGTGGAGAGAGCCCCAACAATCTGCACAACAAAAGGGATTTCAACAAAATCCCCCTGGGTTTCCACGGCCATACCAATCCAACCAACCACCATCGTCCCAAAACAACTCAGGTTCGTCTTTTGATAATTCTCAAGTTATTCAATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.56

Weight (kDa)

10.01

Isoelectric Point (pI)

31.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 55
AcoI YGGCCR 1 cut(s) 178
AfaI GTAC 1 cut(s) 67
AgsI TTSAA 3 cut(s) 111, 154, 253
AjnI CCWGG 1 cut(s) 165
AlwI GGATC 1 cut(s) 55
Ama87I CYCGRG 1 cut(s) 85
AoxI GGCC 2 cut(s) 39, 178
AsuC2I CCSGG 2 cut(s) 86, 87
AsuHPI GGTGA 1 cut(s) 91
AvaI CYCGRG 1 cut(s) 85
BanII GRGCYC 1 cut(s) 125
BccI CCATC 2 cut(s) 2, 210
BceAI ACGGC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 167
BcnI CCSGG 2 cut(s) 86, 87
Bme1390I CCNGG 3 cut(s) 86, 87, 167
BmeT110I CYCGRG 1 cut(s) 85
BmrFI CCNGG 3 cut(s) 86, 87, 167
BpuEI CTTGAG 1 cut(s) 227
BpuMI CCSGG 2 cut(s) 86, 87
BsaBI GATNNNNATC 1 cut(s) 12
BsaJI CCNNGG 6 cut(s) 36, 84, 85, 165, 166, 175
Bse8I GATNNNNATC 1 cut(s) 12
BseBI CCWGG 1 cut(s) 167
BseDI CCNNGG 6 cut(s) 36, 84, 85, 165, 166, 175
BseGI GGATG 1 cut(s) 13
BseJI GATNNNNATC 1 cut(s) 12
BseMII CTCAG 1 cut(s) 233
BsgI GTGCAG 1 cut(s) 119
BshFI GGCC 2 cut(s) 41, 180
BsiHKCI CYCGRG 1 cut(s) 85
BsiSI CCGG 1 cut(s) 86
BslFI GGGAC 1 cut(s) 192
BsmFI GGGAC 1 cut(s) 192
BsnI GGCC 2 cut(s) 41, 180
BsoBI CYCGRG 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 125
Bsp143I GATC 2 cut(s) 60, 96
BspANI GGCC 2 cut(s) 41, 180
BspCNI CTCAG 1 cut(s) 232
BspPI GGATC 1 cut(s) 55
BssECI CCNNGG 6 cut(s) 36, 84, 85, 165, 166, 175
BssMI GATC 2 cut(s) 60, 96
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 219
BstDSI CCRYGG 1 cut(s) 175
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 2 cut(s) 63, 99
BstMBI GATC 2 cut(s) 60, 96
BstNI CCWGG 1 cut(s) 167
BstSCI CCNGG 3 cut(s) 84, 85, 165
BsuRI GGCC 2 cut(s) 41, 180
BtgI CCRYGG 1 cut(s) 175
BtsCI GGATG 1 cut(s) 13
Cfr9I CCCGGG 1 cut(s) 85
Csp6I GTAC 1 cut(s) 66
CviJI RGCY 3 cut(s) 41, 123, 180
CviKI_1 RGCY 3 cut(s) 41, 123, 180
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 1 cut(s) 219
DpnI GATC 2 cut(s) 62, 98
DpnII GATC 2 cut(s) 60, 96
EaeI YGGCCR 1 cut(s) 178
Eco130I CCWWGG 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 125
Eco88I CYCGRG 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 165
EcoT14I CCWWGG 1 cut(s) 36
EcoT38I GRGCYC 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 36
FaiI YATR 2 cut(s) 59, 183
FaqI GGGAC 1 cut(s) 192
FokI GGATG 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 125
HaeIII GGCC 2 cut(s) 41, 180
HapII CCGG 1 cut(s) 86
HinfI GANTC 1 cut(s) 13
HpaII CCGG 1 cut(s) 86
HphI GGTGA 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 219
Kzo9I GATC 2 cut(s) 60, 96
LpnPI CCDG 4 cut(s) 99, 152, 179, 206
MalI GATC 2 cut(s) 62, 98
MboI GATC 2 cut(s) 60, 96
MfeI CAATTG 1 cut(s) 253
MhlI GDGCHC 1 cut(s) 125
MluCI AATT 3 cut(s) 105, 237, 253
MmeI TCCRAC 2 cut(s) 95, 215
MspI CCGG 1 cut(s) 86
MspR9I CCNGG 3 cut(s) 86, 87, 167
MunI CAATTG 1 cut(s) 253
MvaI CCWGG 1 cut(s) 167
NciI CCSGG 2 cut(s) 86, 87
NdeII GATC 2 cut(s) 60, 96
PasI CCCWGGG 1 cut(s) 166
PfeI GAWTC 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 165
PspGI CCWGG 1 cut(s) 165
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
Sau3AI GATC 2 cut(s) 60, 96
ScrFI CCNGG 3 cut(s) 86, 87, 167
SduI GDGCHC 1 cut(s) 125
SetI ASST 2 cut(s) 79, 225
SmaI CCCGGG 1 cut(s) 87
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 3 cut(s) 105, 237, 253
StyD4I CCNGG 3 cut(s) 84, 85, 165
StyI CCWWGG 1 cut(s) 36
TasI AATT 3 cut(s) 105, 237, 253
TfiI GAWTC 1 cut(s) 13
TspGWI ACGGA 1 cut(s) 53
TspMI CCCGGG 1 cut(s) 85
XmaI CCCGGG 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.