pycom15g30420

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0018530
Physical Location & Seq
Reverse (-)
27869339 .. 27869593
255 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g30420.1

Sequence Viewer

Length: 255 bp
ATGGTGGGTGGGAATCTGCCAATGCAATTGGTTTCCAAGGACAAAATCAAAACAACCCATACTCGAACACTTACAATGCCGGATGGAGGGACCATCCAAACTTCAAATGGAGGGAGCCACAACAAGCTGCCCAACAAGGAGGATTTAGGCCAAACCCCCCTGGTTTTTTTTCCAAGCCGTATGCACCCCAACAACCTTCGACATCATCTCATTCAGGTACGTCATTGGAAAGTGATCGATCTCTGCAATTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.51

Weight (kDa)

9.9

Isoelectric Point (pI)

40.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 219
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 105
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
AoxI GGCC 1 cut(s) 148
ApeKI GCWGC 1 cut(s) 127
AspS9I GGNCC 1 cut(s) 90
AvaII GGWCC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 114
BccI CCATC 2 cut(s) 77, 101
BceAI ACGGC 1 cut(s) 162
BciT130I CCWGG 1 cut(s) 161
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 90
BmiI GGNNCC 2 cut(s) 91, 116
BmrFI CCNGG 1 cut(s) 161
Bsa29I ATCGAT 1 cut(s) 237
BsaJI CCNNGG 2 cut(s) 36, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseBI CCWGG 1 cut(s) 161
BseCI ATCGAT 1 cut(s) 237
BseDI CCNNGG 2 cut(s) 36, 159
BseGI GGATG 2 cut(s) 88, 93
BseLI CCNNNNNNNGG 1 cut(s) 86
BseXI GCAGC 1 cut(s) 114
BshFI GGCC 1 cut(s) 150
BshVI ATCGAT 1 cut(s) 237
BsiSI CCGG 1 cut(s) 80
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 2 cut(s) 234, 238
BspANI GGCC 1 cut(s) 150
BspDI ATCGAT 1 cut(s) 237
BspLI GGNNCC 2 cut(s) 91, 116
BssECI CCNNGG 2 cut(s) 36, 159
BssMI GATC 2 cut(s) 234, 238
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 161
BstF5I GGATG 2 cut(s) 88, 93
BstKTI GATC 2 cut(s) 237, 241
BstMBI GATC 2 cut(s) 234, 238
BstNI CCWGG 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 114
Bsu15I ATCGAT 1 cut(s) 237
BsuRI GGCC 1 cut(s) 150
BsuTUI ATCGAT 1 cut(s) 237
BtsCI GGATG 2 cut(s) 88, 93
Cfr13I GGNCC 1 cut(s) 90
ClaI ATCGAT 1 cut(s) 237
Csp6I GTAC 1 cut(s) 218
CviJI RGCY 4 cut(s) 117, 127, 150, 177
CviKI_1 RGCY 4 cut(s) 117, 127, 150, 177
CviQI GTAC 1 cut(s) 218
DpnI GATC 2 cut(s) 236, 240
DpnII GATC 2 cut(s) 234, 238
Eco130I CCWWGG 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaiI YATR 2 cut(s) 60, 182
FaqI GGGAC 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 128
FokI GGATG 2 cut(s) 80, 95
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
HaeIII GGCC 1 cut(s) 150
HapII CCGG 1 cut(s) 80
HinfI GANTC 1 cut(s) 13
HpaII CCGG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 206
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 3 cut(s) 25, 184, 246
HpySE526I ACGT 1 cut(s) 220
Kzo9I GATC 2 cut(s) 234, 238
LmnI GCTCC 1 cut(s) 114
LpnPI CCDG 4 cut(s) 93, 146, 173, 200
Lsp1109I GCAGC 1 cut(s) 114
MaeII ACGT 1 cut(s) 220
MalI GATC 2 cut(s) 236, 240
MboI GATC 2 cut(s) 234, 238
MfeI CAATTG 1 cut(s) 26
MluCI AATT 2 cut(s) 26, 247
MnlI CCTC 3 cut(s) 80, 104, 133
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 161
MunI CAATTG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 161
NdeII GATC 2 cut(s) 234, 238
NlaIV GGNNCC 2 cut(s) 91, 116
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspN4I GGNNCC 2 cut(s) 91, 116
PspPI GGNCC 1 cut(s) 90
RsaI GTAC 1 cut(s) 219
RsaNI GTAC 1 cut(s) 218
SatI GCNGC 1 cut(s) 128
Sau3AI GATC 2 cut(s) 234, 238
Sau96I GGNCC 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 161
SetI ASST 4 cut(s) 129, 198, 219, 223
SgeI CNNG 9 cut(s) 49, 75, 92, 136, 148, 172, 173, 186, 227
SinI GGWCC 1 cut(s) 90
Sse9I AATT 2 cut(s) 26, 247
StyD4I CCNGG 1 cut(s) 159
StyI CCWWGG 1 cut(s) 36
TaiI ACGT 1 cut(s) 223
TaqI TCGA 3 cut(s) 64, 199, 237
TasI AATT 2 cut(s) 26, 247
TfiI GAWTC 1 cut(s) 13
TseI GCWGC 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 90
XcmI CCANNNNNNNNNTGG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.