pycom1217g00050

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001217
Physical Location & Seq
Forward (+)
25415 .. 27881
2467 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1217g00050.2

Sequence Viewer

Length: 279 bp
ATGATGCTTCTGAGAAGTGCCCACAACTCATTGAAAATGGTGGATGGGAAAGCGCAAATGCAATTGGGTTTCAAGGCCAAAACCAACCAAGGAACGATCCGTATTCTAACACCTACAATCCAGGTTGGAGAGACCACCCGAACTTTAAGTGGAGGGAGCCCCAACAACCACCACAACAAGGAGGCTTTAGGCAACAACCCCCGGGCTTCTACAACAAGCCATACGCACCCACACAAGCACCTCCACAATCTGCCCAAACAAGTTCAGGTAACACCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.09

Weight (kDa)

11.13

Isoelectric Point (pI)

27.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 178
AgsI TTSAA 2 cut(s) 34, 73
AjnI CCWGG 1 cut(s) 120
Alw26I GTCTC 1 cut(s) 125
AlwI GGATC 1 cut(s) 91
Ama87I CYCGRG 1 cut(s) 201
AoxI GGCC 1 cut(s) 75
AspLEI GCGC 1 cut(s) 55
AsuC2I CCSGG 2 cut(s) 202, 203
AvaI CYCGRG 1 cut(s) 201
BaeGI GKGCMC 1 cut(s) 22
BanII GRGCYC 1 cut(s) 161
BccI CCATC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 122
BcnI CCSGG 2 cut(s) 202, 203
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 277
Bme1390I CCNGG 3 cut(s) 122, 202, 203
BmeT110I CYCGRG 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 158
BmrFI CCNGG 3 cut(s) 122, 202, 203
BpuMI CCSGG 2 cut(s) 202, 203
BsaI GGTCTC 1 cut(s) 125
BsaJI CCNNGG 3 cut(s) 88, 200, 201
Bsc4I CCNNNNNNNGG 1 cut(s) 178
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 3 cut(s) 88, 200, 201
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 178
BseSI GKGCMC 1 cut(s) 22
BshFI GGCC 1 cut(s) 77
BsiHKCI CYCGRG 1 cut(s) 201
BsiSI CCGG 1 cut(s) 202
BslI CCNNNNNNNGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 125
BsnI GGCC 1 cut(s) 77
Bso31I GGTCTC 1 cut(s) 125
BsoBI CYCGRG 1 cut(s) 201
Bsp1286I GDGCHC 2 cut(s) 22, 161
Bsp143I GATC 1 cut(s) 96
BspANI GGCC 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 158
BspPI GGATC 1 cut(s) 91
BspTNI GGTCTC 1 cut(s) 125
BssECI CCNNGG 3 cut(s) 88, 200, 201
BssMI GATC 1 cut(s) 96
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 11
BstF5I GGATG 1 cut(s) 49
BstHHI GCGC 1 cut(s) 55
BstKTI GATC 1 cut(s) 99
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 1 cut(s) 96
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 3 cut(s) 120, 200, 201
BstSLI GKGCMC 1 cut(s) 22
BsuRI GGCC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 49
CfoI GCGC 1 cut(s) 55
Cfr9I CCCGGG 1 cut(s) 201
CviJI RGCY 5 cut(s) 77, 159, 185, 206, 219
CviKI_1 RGCY 5 cut(s) 77, 159, 185, 206, 219
DdeI CTNAG 1 cut(s) 11
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco130I CCWWGG 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 161
Eco31I GGTCTC 1 cut(s) 125
Eco88I CYCGRG 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 161
ErhI CCWWGG 1 cut(s) 88
FaiI YATR 1 cut(s) 222
FokI GGATG 1 cut(s) 56
FriOI GRGCYC 1 cut(s) 161
FspBI CTAG 1 cut(s) 277
GlaI GCGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 77
HapII CCGG 1 cut(s) 202
HhaI GCGC 1 cut(s) 55
Hin6I GCGC 1 cut(s) 53
HinP1I GCGC 1 cut(s) 53
HpaII CCGG 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 12
HpyCH4V TGCA 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 11
HspAI GCGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 156
LpnPI CCDG 4 cut(s) 107, 134, 215, 251
MaeI CTAG 1 cut(s) 277
MaeIII GTNAC 1 cut(s) 268
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MfeI CAATTG 1 cut(s) 62
MhlI GDGCHC 2 cut(s) 22, 161
MluCI AATT 1 cut(s) 62
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 3 cut(s) 146, 175, 251
MseI TTAA 1 cut(s) 146
MspI CCGG 1 cut(s) 202
MspR9I CCNGG 3 cut(s) 122, 202, 203
MunI CAATTG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 122
NciI CCSGG 2 cut(s) 202, 203
NdeII GATC 1 cut(s) 96
NlaIV GGNNCC 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 158
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 1 cut(s) 96
ScrFI CCNGG 3 cut(s) 122, 202, 203
SduI GDGCHC 2 cut(s) 22, 161
SetI ASST 4 cut(s) 115, 126, 243, 270
SmaI CCCGGG 1 cut(s) 203
Sse9I AATT 1 cut(s) 62
SspMI CTAG 1 cut(s) 277
StyD4I CCNGG 3 cut(s) 120, 200, 201
StyI CCWWGG 1 cut(s) 88
TasI AATT 1 cut(s) 62
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TspGWI ACGGA 1 cut(s) 89
TspMI CCCGGG 1 cut(s) 201
XmaI CCCGGG 1 cut(s) 201
XspI CTAG 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.