pycom15g23670

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0018530
Physical Location & Seq
Forward (+)
17824137 .. 17824400
264 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g23670.1

Sequence Viewer

Length: 264 bp
ATGGTGGGTGGGAATCTGCCAATGCAATTGGTTTCCAAGGACAAAATCAAAACAACCCATACTCGAACACTTACAATGCCGGATGGAGGGACCATCCAAACTTCAAATGGAGGGAGCCACAACAAGCTGCCCAACAAGGAGGATTTAGGCCAAACCCCCCTGGTTTTTATTCCAAGCCGTATGCACCCCAACAACCCCAACAACCTTCGACATCATCTCATTCAGGTACGTCCTTGGAAAGTGATCAAGCTATGCAATTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.78

Weight (kDa)

10.22

Isoelectric Point (pI)

34.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 228
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 105
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 2 cut(s) 127, 250
AluI AGCT 2 cut(s) 127, 250
AoxI GGCC 1 cut(s) 148
ApeKI GCWGC 1 cut(s) 127
AspS9I GGNCC 1 cut(s) 90
AvaII GGWCC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 114
BccI CCATC 2 cut(s) 77, 101
BceAI ACGGC 1 cut(s) 162
BciT130I CCWGG 1 cut(s) 161
BclI TGATCA 1 cut(s) 243
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 90
BmiI GGNNCC 2 cut(s) 91, 116
BmrFI CCNGG 1 cut(s) 161
BsaJI CCNNGG 3 cut(s) 36, 159, 233
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 3 cut(s) 36, 159, 233
BseGI GGATG 2 cut(s) 88, 93
BseLI CCNNNNNNNGG 1 cut(s) 86
BseXI GCAGC 1 cut(s) 114
BshFI GGCC 1 cut(s) 150
BsiSI CCGG 1 cut(s) 80
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 243
BspANI GGCC 1 cut(s) 150
BspLI GGNNCC 2 cut(s) 91, 116
BssECI CCNNGG 3 cut(s) 36, 159, 233
BssMI GATC 1 cut(s) 243
BssT1I CCWWGG 2 cut(s) 36, 233
Bst2UI CCWGG 1 cut(s) 161
BstF5I GGATG 2 cut(s) 88, 93
BstKTI GATC 1 cut(s) 246
BstMBI GATC 1 cut(s) 243
BstNI CCWGG 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 114
BsuRI GGCC 1 cut(s) 150
BtsCI GGATG 2 cut(s) 88, 93
Cfr13I GGNCC 1 cut(s) 90
Csp6I GTAC 1 cut(s) 227
CviJI RGCY 5 cut(s) 117, 127, 150, 177, 250
CviKI_1 RGCY 5 cut(s) 117, 127, 150, 177, 250
CviQI GTAC 1 cut(s) 227
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
Eco130I CCWWGG 2 cut(s) 36, 233
Eco47I GGWCC 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 159
EcoT14I CCWWGG 2 cut(s) 36, 233
ErhI CCWWGG 2 cut(s) 36, 233
FaiI YATR 3 cut(s) 60, 182, 253
FaqI GGGAC 1 cut(s) 103
FbaI TGATCA 1 cut(s) 243
Fnu4HI GCNGC 1 cut(s) 128
FokI GGATG 2 cut(s) 80, 95
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
HaeIII GGCC 1 cut(s) 150
HapII CCGG 1 cut(s) 80
HinfI GANTC 1 cut(s) 13
HpaII CCGG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 215
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 25, 184, 255
HpySE526I ACGT 1 cut(s) 229
Ksp22I TGATCA 1 cut(s) 243
Kzo9I GATC 1 cut(s) 243
LmnI GCTCC 1 cut(s) 114
LpnPI CCDG 4 cut(s) 93, 146, 173, 209
Lsp1109I GCAGC 1 cut(s) 114
MaeII ACGT 1 cut(s) 229
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MfeI CAATTG 1 cut(s) 26
MluCI AATT 2 cut(s) 26, 256
MnlI CCTC 3 cut(s) 80, 104, 133
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 161
MunI CAATTG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 161
NdeII GATC 1 cut(s) 243
NlaIV GGNNCC 2 cut(s) 91, 116
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspN4I GGNNCC 2 cut(s) 91, 116
PspPI GGNCC 1 cut(s) 90
RsaI GTAC 1 cut(s) 228
RsaNI GTAC 1 cut(s) 227
SatI GCNGC 1 cut(s) 128
Sau3AI GATC 1 cut(s) 243
Sau96I GGNCC 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 161
SetI ASST 5 cut(s) 129, 207, 228, 232, 252
SinI GGWCC 1 cut(s) 90
Sse9I AATT 2 cut(s) 26, 256
StyD4I CCNGG 1 cut(s) 159
StyI CCWWGG 2 cut(s) 36, 233
TaiI ACGT 1 cut(s) 232
TaqI TCGA 2 cut(s) 64, 208
TasI AATT 2 cut(s) 26, 256
TfiI GAWTC 1 cut(s) 13
TseI GCWGC 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 90
XcmI CCANNNNNNNNNTGG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.