pycom10g13680

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0018530
Physical Location & Seq
Forward (+)
17141961 .. 17142239
279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g13680.1

Sequence Viewer

Length: 279 bp
ATGGAGGATGGGAATCTGCCAATGCCGTGGGTTATGGGAATCAAAACCAACCGAGGAATGATCGATATTCTAACACATATAATCCAGGTTGGAGAGACCATCCAAATTTCAAATGGCTGGATCCTCAACAACCCCAACAACAAGGAGGATTTAGGCAGCAACCACCGGGCTTTTATACAAAGCCATTCATCCCTAATCAAAACCAAGTGCAATCTGCCCCAACAACCTCAGGTATGTCTTTGGATAATGATCAAGTTGTTAAGTTACTTACTACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.48

Weight (kDa)

7.84

Isoelectric Point (pI)

40.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 115, 128
AcsI RAATTY 1 cut(s) 105
AgsI TTSAA 1 cut(s) 111
AjnI CCWGG 1 cut(s) 84
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 2 cut(s) 115, 128
ApeKI GCWGC 1 cut(s) 156
ApoI RAATTY 1 cut(s) 105
AsuC2I CCSGG 1 cut(s) 167
AxyI CCTNAGG 1 cut(s) 228
BamHI GGATCC 1 cut(s) 120
BbvI GCAGC 1 cut(s) 168
BccI CCATC 2 cut(s) 2, 107
BceAI ACGGC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 86
BclI TGATCA 1 cut(s) 249
BcnI CCSGG 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 89
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme1390I CCNGG 2 cut(s) 86, 167
BmiI GGNNCC 1 cut(s) 122
BmrFI CCNGG 2 cut(s) 86, 167
BpuMI CCSGG 1 cut(s) 167
Bsa29I ATCGAT 1 cut(s) 63
BsaBI GATNNNNATC 2 cut(s) 12, 248
BsaI GGTCTC 1 cut(s) 89
BsaJI CCNNGG 2 cut(s) 26, 52
Bse21I CCTNAGG 1 cut(s) 228
Bse8I GATNNNNATC 2 cut(s) 12, 248
BseBI CCWGG 1 cut(s) 86
BseCI ATCGAT 1 cut(s) 63
BseDI CCNNGG 2 cut(s) 26, 52
BseGI GGATG 3 cut(s) 13, 99, 188
BseJI GATNNNNATC 2 cut(s) 12, 248
BseMII CTCAG 1 cut(s) 242
BseXI GCAGC 1 cut(s) 168
BshVI ATCGAT 1 cut(s) 63
BsiSI CCGG 1 cut(s) 166
BsmAI GTCTC 1 cut(s) 89
Bso31I GGTCTC 1 cut(s) 89
Bsp143I GATC 3 cut(s) 60, 120, 249
BspCNI CTCAG 1 cut(s) 241
BspDI ATCGAT 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 122
BspPI GGATC 2 cut(s) 115, 128
BspTNI GGTCTC 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 26, 52
BssMI GATC 3 cut(s) 60, 120, 249
Bst2UI CCWGG 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 228
BstDSI CCRYGG 1 cut(s) 26
BstF5I GGATG 3 cut(s) 13, 99, 188
BstKTI GATC 3 cut(s) 63, 123, 252
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 3 cut(s) 60, 120, 249
BstNI CCWGG 1 cut(s) 86
BstSCI CCNGG 2 cut(s) 84, 165
BstV1I GCAGC 1 cut(s) 168
BstX2I RGATCY 1 cut(s) 120
BstXI CCANNNNNNTGG 1 cut(s) 27
BstYI RGATCY 1 cut(s) 120
Bsu15I ATCGAT 1 cut(s) 63
Bsu36I CCTNAGG 1 cut(s) 228
BsuTUI ATCGAT 1 cut(s) 63
BtgI CCRYGG 1 cut(s) 26
BtsCI GGATG 3 cut(s) 13, 99, 188
ClaI ATCGAT 1 cut(s) 63
CviJI RGCY 3 cut(s) 117, 170, 183
CviKI_1 RGCY 3 cut(s) 117, 170, 183
DdeI CTNAG 1 cut(s) 228
DpnI GATC 3 cut(s) 62, 122, 251
DpnII GATC 3 cut(s) 60, 120, 249
Eco31I GGTCTC 1 cut(s) 89
Eco81I CCTNAGG 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 84
FaiI YATR 5 cut(s) 35, 78, 80, 176, 235
FbaI TGATCA 1 cut(s) 249
Fnu4HI GCNGC 1 cut(s) 157
FokI GGATG 3 cut(s) 20, 86, 175
Fsp4HI GCNGC 1 cut(s) 157
GluI GCNGC 1 cut(s) 157
HapII CCGG 1 cut(s) 166
HinfI GANTC 2 cut(s) 13, 39
HpaII CCGG 1 cut(s) 166
HpyCH4V TGCA 1 cut(s) 210
HpyF3I CTNAG 1 cut(s) 228
Ksp22I TGATCA 1 cut(s) 249
Kzo9I GATC 3 cut(s) 60, 120, 249
LpnPI CCDG 5 cut(s) 71, 98, 103, 179, 215
Lsp1109I GCAGC 1 cut(s) 168
MaeIII GTNAC 1 cut(s) 263
MalI GATC 3 cut(s) 62, 122, 251
MboI GATC 3 cut(s) 60, 120, 249
MflI RGATCY 1 cut(s) 120
MluCI AATT 1 cut(s) 105
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 4 cut(s) 47, 134, 139, 237
MseI TTAA 1 cut(s) 260
MspI CCGG 1 cut(s) 166
MspR9I CCNGG 2 cut(s) 86, 167
MvaI CCWGG 1 cut(s) 86
NciI CCSGG 1 cut(s) 167
NdeII GATC 3 cut(s) 60, 120, 249
NlaIV GGNNCC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 13, 39
PkrI GCNGC 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 122
PsuI RGATCY 1 cut(s) 120
SaqAI TTAA 1 cut(s) 260
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 3 cut(s) 60, 120, 249
ScrFI CCNGG 2 cut(s) 86, 167
SetI ASST 3 cut(s) 90, 229, 234
Sse9I AATT 1 cut(s) 105
StyD4I CCNGG 2 cut(s) 84, 165
TaqI TCGA 1 cut(s) 63
TasI AATT 1 cut(s) 105
TfiI GAWTC 2 cut(s) 13, 39
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TseI GCWGC 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 177
XapI RAATTY 1 cut(s) 105
XcmI CCANNNNNNNNNTGG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.