pycom01g18980

ceramide glucosyltransferase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
17758564 .. 17760089
1526 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g18980.3

Sequence Viewer

Length: 282 bp
ATGCTACTATCAGAGCTTAAGGACGAGGTTGATGTTAAGATTGTTGTGGCTGGTATTTCAACAACCTGCAGTCAGAAAATTCACAACCAATTGCAAAAAACCTTGCGGCGAGCAAACTGGCACAACCAATTCTGCCAGAATTGCTGGAGAATTCCACAACCAAGGTCATCGAGTACGGCCAGAAGCATGTTGAGGGTCGAGACGGCGATAGCACCGATGTTGGCAAGAGCGGCGACCCCTTTTCAAGATTGTTGGGTCCAAAAGAAGAAGAAGAAGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.72

Weight (kDa)

9.97

Isoelectric Point (pI)

51.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019769)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 74
AccBSI CCGCTC 1 cut(s) 230
AciI CCGC 2 cut(s) 106, 230
AcoI YGGCCR 1 cut(s) 177
AcsI RAATTY 2 cut(s) 78, 150
AfaI GTAC 1 cut(s) 175
AflII CTTAAG 1 cut(s) 17
AgsI TTSAA 2 cut(s) 60, 245
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 194
AoxI GGCC 1 cut(s) 177
ApoI RAATTY 2 cut(s) 78, 150
AspS9I GGNCC 1 cut(s) 256
AvaII GGWCC 1 cut(s) 256
BceAI ACGGC 2 cut(s) 192, 219
BcoDI GTCTC 1 cut(s) 194
BfmI CTRYAG 1 cut(s) 67
BfrI CTTAAG 1 cut(s) 17
BfuAI ACCTGC 1 cut(s) 74
BisI GCNGC 2 cut(s) 107, 231
BlsI GCNGC 2 cut(s) 108, 232
Bme18I GGWCC 1 cut(s) 256
BmgT120I GGNCC 1 cut(s) 256
BmiI GGNNCC 1 cut(s) 257
BpmI CTGGAG 1 cut(s) 166
BsaJI CCNNGG 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 122
BshFI GGCC 1 cut(s) 179
BsmAI GTCTC 1 cut(s) 194
BsmBI CGTCTC 1 cut(s) 194
BsnI GGCC 1 cut(s) 179
BspACI CCGC 2 cut(s) 106, 230
BspANI GGCC 1 cut(s) 179
BspLI GGNNCC 1 cut(s) 257
BspMAI CTGCAG 1 cut(s) 71
BspMI ACCTGC 1 cut(s) 74
BspTI CTTAAG 1 cut(s) 17
BsrBI CCGCTC 1 cut(s) 230
BsrI ACTGG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 161
BssT1I CCWWGG 1 cut(s) 161
BstAFI CTTAAG 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 111
BstMAI GTCTC 1 cut(s) 194
BstMWI GCNNNNNNNGC 2 cut(s) 141, 230
BstNSI RCATGY 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 67
BsuRI GGCC 1 cut(s) 179
BveI ACCTGC 1 cut(s) 74
Cac8I GCNNGC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 256
Csp6I GTAC 1 cut(s) 174
CviAII CATG 1 cut(s) 187
CviJI RGCY 3 cut(s) 16, 50, 179
CviKI_1 RGCY 3 cut(s) 16, 50, 179
CviQI GTAC 1 cut(s) 174
EaeI YGGCCR 1 cut(s) 177
Eco130I CCWWGG 1 cut(s) 161
Eco47I GGWCC 1 cut(s) 256
EcoRI GAATTC 1 cut(s) 150
EcoT14I CCWWGG 1 cut(s) 161
ErhI CCWWGG 1 cut(s) 161
Esp3I CGTCTC 1 cut(s) 194
FaeI CATG 1 cut(s) 190
FaiI YATR 1 cut(s) 188
FatI CATG 1 cut(s) 186
Fnu4HI GCNGC 2 cut(s) 107, 231
Fsp4HI GCNGC 2 cut(s) 107, 231
GluI GCNGC 2 cut(s) 107, 231
GsuI CTGGAG 1 cut(s) 166
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 13, 75
Hpy188III TCNNGA 2 cut(s) 199, 245
HpyAV CCTTC 1 cut(s) 268
HpyCH4V TGCA 2 cut(s) 69, 94
HpyF10VI GCNNNNNNNGC 2 cut(s) 141, 230
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 6 cut(s) 36, 79, 103, 130, 149, 193
MbiI CCGCTC 1 cut(s) 230
MboII GAAGA 2 cut(s) 277, 280
MfeI CAATTG 1 cut(s) 89
MluCI AATT 5 cut(s) 78, 89, 128, 139, 150
MnlI CCTC 2 cut(s) 19, 186
MseI TTAA 2 cut(s) 18, 36
MspCI CTTAAG 1 cut(s) 17
MunI CAATTG 1 cut(s) 89
MwoI GCNNNNNNNGC 2 cut(s) 141, 230
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 1 cut(s) 257
NspI RCATGY 1 cut(s) 190
PkrI GCNGC 2 cut(s) 108, 232
PspN4I GGNNCC 1 cut(s) 257
PspPI GGNCC 1 cut(s) 256
PstI CTGCAG 1 cut(s) 71
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SaqAI TTAA 2 cut(s) 18, 36
SatI GCNGC 2 cut(s) 107, 231
Sau96I GGNCC 1 cut(s) 256
SetI ASST 5 cut(s) 18, 30, 68, 104, 167
SfcI CTRYAG 1 cut(s) 67
SinI GGWCC 1 cut(s) 256
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 5 cut(s) 78, 89, 128, 139, 150
SsiI CCGC 2 cut(s) 106, 230
StyI CCWWGG 1 cut(s) 161
TaqI TCGA 2 cut(s) 170, 198
TasI AATT 5 cut(s) 78, 89, 128, 139, 150
TauI GCSGC 2 cut(s) 109, 233
Tru1I TTAA 2 cut(s) 18, 36
Tru9I TTAA 2 cut(s) 18, 36
Vha464I CTTAAG 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 256
XapI RAATTY 2 cut(s) 78, 150
XceI RCATGY 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.