pycom09g10610

Glycosyl transferase family 21

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
8671952 .. 8672416
465 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g10610.3

Sequence Viewer

Length: 198 bp
ATGTCTTATCTGGTCACTTTTCTCTATGGTGGTCCCTTAGAGTTTTTGTTTATCGTGGAAAGCACAGAAAACCCTGCTTATCGGGCTATATCTATGGTACTATCAGAGCTTAAGGATGAGGTTGATGCTAAGATTGTTGTGGCTGGTATTTCAACAGCCTGCAGTCAAAAAATTCACAACCGATTGGTATGTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.18

Weight (kDa)

5.09

Isoelectric Point (pI)

36.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019769)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 171
AfaI GTAC 2 cut(s) 99, 193
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 153
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
ApoI RAATTY 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 32
AvaII GGWCC 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 160
BfrI CTTAAG 1 cut(s) 110
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 34
BmsI GCATC 1 cut(s) 115
BseGI GGATG 1 cut(s) 121
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 34
BspMAI CTGCAG 1 cut(s) 164
BspTI CTTAAG 1 cut(s) 110
BstAFI CTTAAG 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 160
BstDEI CTNAG 2 cut(s) 37, 129
BstF5I GGATG 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 160
BtsCI GGATG 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 160
Cfr13I GGNCC 1 cut(s) 32
Csp6I GTAC 2 cut(s) 98, 192
CviJI RGCY 4 cut(s) 86, 109, 143, 158
CviKI_1 RGCY 4 cut(s) 86, 109, 143, 158
CviQI GTAC 2 cut(s) 98, 192
DdeI CTNAG 2 cut(s) 37, 129
Eco47I GGWCC 1 cut(s) 32
FaiI YATR 4 cut(s) 27, 89, 95, 190
FaqI GGGAC 1 cut(s) 18
FokI GGATG 1 cut(s) 128
Hpy188I TCNGA 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 2 cut(s) 37, 129
LpnPI CCDG 3 cut(s) 87, 129, 172
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 13
MluCI AATT 1 cut(s) 171
MnlI CCTC 1 cut(s) 112
MseI TTAA 1 cut(s) 111
MspCI CTTAAG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 1 cut(s) 32
PstI CTGCAG 1 cut(s) 164
RsaI GTAC 2 cut(s) 99, 193
RsaNI GTAC 2 cut(s) 98, 192
SaqAI TTAA 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 32
SetI ASST 3 cut(s) 111, 123, 197
SfaNI GCATC 1 cut(s) 115
SfcI CTRYAG 1 cut(s) 160
SgeI CNNG 6 cut(s) 23, 67, 86, 95, 156, 171
SinI GGWCC 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 1 cut(s) 171
TasI AATT 1 cut(s) 171
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TseFI GTSAC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 13
Vha464I CTTAAG 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 32
XapI RAATTY 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.