pycom04g13220

Belongs to the CDP-alcohol phosphatidyltransferase class-I family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
16194693 .. 16194993
301 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g13220.2

Sequence Viewer

Length: 195 bp
ATGCTTGGAGACGACGAGGCGTTGGAGACGGTCATGGAAGTTGGGTCACTATCGTCCACTCCGACGGTCGTGGATCGCCGTGTCAAGTTGAAAACGGGCGTTGACGATTCTGTCAATTTGCCCAATTTGATCTCCATGAGTCAGTTGATTTCAGGTCCTTTCCTTGGATGGCTGATTCGATCTTCAAACCAGTAA

Protein Analysis

65

Amino Acids

6.92

Weight (kDa)

4.46

Isoelectric Point (pI)

41.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018291)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G14104
fragaria_vesca FvH4_3g23710
malus_domestica MD05G1343100.v1.1
pyrus_communis pycom04g13220 pycom05g25750
rosa_chinensis RchiOBHm_Chr1g0313051
rosa_roxburghii Rroxscaffold_1G00013670
rosa_rugosa Rorug05G0384700
rosa_samantha Rh2CG490700 Rh6DG101600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 110
AclWI GGATC 1 cut(s) 81
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 91, 186
Alw26I GTCTC 2 cut(s) 3, 20
AlwI GGATC 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 155
AvaII GGWCC 1 cut(s) 155
BccI CCATC 1 cut(s) 162
BceAI ACGGC 1 cut(s) 63
BcoDI GTCTC 2 cut(s) 3, 20
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 190
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 1 cut(s) 173
BseLI CCNNNNNNNGG 1 cut(s) 164
BseNI ACTGG 1 cut(s) 190
Bsh1285I CGRYCG 1 cut(s) 69
BsiEI CGRYCG 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 2 cut(s) 3, 20
BsmBI CGTCTC 2 cut(s) 3, 20
Bsp143I GATC 3 cut(s) 73, 129, 179
BspPI GGATC 1 cut(s) 81
BsrI ACTGG 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 3 cut(s) 73, 129, 179
BssT1I CCWWGG 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 31, 67
BstF5I GGATG 1 cut(s) 173
BstKTI GATC 3 cut(s) 76, 132, 182
BstMAI GTCTC 2 cut(s) 3, 20
BstMBI GATC 3 cut(s) 73, 129, 179
BstMCI CGRYCG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 155
CviAII CATG 2 cut(s) 34, 136
CviJI RGCY 1 cut(s) 172
CviKI_1 RGCY 1 cut(s) 172
DpnI GATC 3 cut(s) 75, 131, 181
DpnII GATC 3 cut(s) 73, 129, 179
DrdI GACNNNNNNGTC 1 cut(s) 110
DseDI GACNNNNNNGTC 1 cut(s) 110
Eco130I CCWWGG 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 155
EcoO109I RGGNCCY 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 163
Esp3I CGTCTC 2 cut(s) 3, 20
FaeI CATG 2 cut(s) 37, 139
FaiI YATR 2 cut(s) 35, 137
FatI CATG 2 cut(s) 33, 135
FokI GGATG 1 cut(s) 180
Hin1II CATG 2 cut(s) 37, 139
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 3 cut(s) 107, 139, 175
Hpy166II GTNNAC 2 cut(s) 57, 103
Hpy188I TCNGA 1 cut(s) 63
Hpy8I GTNNAC 2 cut(s) 57, 103
Hpy99I CGWCG 2 cut(s) 17, 67
HpyCH4III ACNGT 2 cut(s) 31, 67
Hsp92II CATG 2 cut(s) 37, 139
Kzo9I GATC 3 cut(s) 73, 129, 179
LpnPI CCDG 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 45
MalI GATC 3 cut(s) 75, 131, 181
MboI GATC 3 cut(s) 73, 129, 179
MboII GAAGA 1 cut(s) 174
MluCI AATT 2 cut(s) 115, 124
MlyI GAGTC 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 86
MnlI CCTC 1 cut(s) 10
NdeII GATC 3 cut(s) 73, 129, 179
NlaIII CATG 2 cut(s) 37, 139
NmuCI GTSAC 1 cut(s) 45
PcsI WCGNNNNNNNCGW 1 cut(s) 59
PfeI GAWTC 2 cut(s) 107, 175
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
PpuMI RGGWCCY 1 cut(s) 155
Psp5II RGGWCCY 1 cut(s) 155
PspPI GGNCC 1 cut(s) 155
PspPPI RGGWCCY 1 cut(s) 155
Sau3AI GATC 3 cut(s) 73, 129, 179
Sau96I GGNCC 1 cut(s) 155
SchI GAGTC 1 cut(s) 148
SetI ASST 1 cut(s) 157
SinI GGWCC 1 cut(s) 155
Sse9I AATT 2 cut(s) 115, 124
StyI CCWWGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 31, 67
TaqI TCGA 1 cut(s) 178
TasI AATT 2 cut(s) 115, 124
TfiI GAWTC 2 cut(s) 107, 175
TseFI GTSAC 1 cut(s) 45
Tsp45I GTSAC 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.