pycom05g25750

Belongs to the CDP-alcohol phosphatidyltransferase class-I family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
27091820 .. 27092050
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g25750.1

Sequence Viewer

Length: 231 bp
ATGCTTGGATCTAATCTCACAAACCCAGTTGGAGTTGCGGAGGCGCATGCTTGGAGACGACGAGGCGTTGGAGACGGTTATGGAAGTTGGGTCACTATCGCCAGCTCCGACGGTCGTGGATCGATCCGTGTCAGGTTGAAACAGGGTGCTGACGATTTCGTCAATTTGCCCAATTTGATCTCCATGAGTTGGTTGATTTCAGGTCCTTTCCTTGGATGTAACAATTACTAA

Protein Analysis

77

Amino Acids

8.18

Weight (kDa)

9.18

Isoelectric Point (pI)

28.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018291)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G14104
fragaria_vesca FvH4_3g23710
malus_domestica MD05G1343100.v1.1
pyrus_communis pycom04g13220 pycom05g25750
rosa_chinensis RchiOBHm_Chr1g0313051
rosa_roxburghii Rroxscaffold_1G00013670
rosa_rugosa Rorug05G0384700
rosa_samantha Rh2CG490700 Rh6DG101600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 158
AccB7I CCANNNNNTGG 1 cut(s) 189
AciI CCGC 1 cut(s) 38
AclWI GGATC 3 cut(s) 16, 118, 127
AfiI CCNNNNNNNGG 2 cut(s) 189, 212
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw26I GTCTC 2 cut(s) 49, 66
AlwI GGATC 3 cut(s) 16, 118, 127
AspLEI GCGC 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 203
AvaII GGWCC 1 cut(s) 203
BcoDI GTCTC 2 cut(s) 49, 66
Bme18I GGWCC 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 203
BmrI ACTGGG 1 cut(s) 20
BmuI ACTGGG 1 cut(s) 20
Bsa29I ATCGAT 1 cut(s) 122
BsaJI CCNNGG 1 cut(s) 211
Bsc4I CCNNNNNNNGG 2 cut(s) 189, 212
Bse1I ACTGG 1 cut(s) 26
BseCI ATCGAT 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 211
BseGI GGATG 1 cut(s) 221
BseLI CCNNNNNNNGG 2 cut(s) 189, 212
BseNI ACTGG 1 cut(s) 26
Bsh1285I CGRYCG 1 cut(s) 115
BshVI ATCGAT 1 cut(s) 122
BsiEI CGRYCG 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 189, 212
BsmAI GTCTC 2 cut(s) 49, 66
BsmBI CGTCTC 2 cut(s) 49, 66
Bsp143I GATC 4 cut(s) 8, 119, 123, 177
BspACI CCGC 1 cut(s) 38
BspDI ATCGAT 1 cut(s) 122
BspPI GGATC 3 cut(s) 16, 118, 127
BsrI ACTGG 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 211
BssMI GATC 4 cut(s) 8, 119, 123, 177
BssT1I CCWWGG 1 cut(s) 211
Bst4CI ACNGT 2 cut(s) 77, 113
BstC8I GCNNGC 2 cut(s) 48, 103
BstF5I GGATG 1 cut(s) 221
BstHHI GCGC 1 cut(s) 46
BstKTI GATC 4 cut(s) 11, 122, 126, 180
BstMAI GTCTC 2 cut(s) 49, 66
BstMBI GATC 4 cut(s) 8, 119, 123, 177
BstMCI CGRYCG 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 50
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
Bsu15I ATCGAT 1 cut(s) 122
BsuTUI ATCGAT 1 cut(s) 122
BtsCI GGATG 1 cut(s) 221
Cac8I GCNNGC 2 cut(s) 48, 103
CfoI GCGC 1 cut(s) 46
Cfr13I GGNCC 1 cut(s) 203
ClaI ATCGAT 1 cut(s) 122
CviAII CATG 2 cut(s) 47, 184
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
DpnI GATC 4 cut(s) 10, 121, 125, 179
DpnII GATC 4 cut(s) 8, 119, 123, 177
DrdI GACNNNNNNGTC 1 cut(s) 158
DseDI GACNNNNNNGTC 1 cut(s) 158
Eco130I CCWWGG 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 203
EcoO109I RGGNCCY 1 cut(s) 203
EcoT14I CCWWGG 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 211
Esp3I CGTCTC 2 cut(s) 49, 66
FaeI CATG 2 cut(s) 50, 187
FaiI YATR 3 cut(s) 48, 81, 185
FatI CATG 2 cut(s) 46, 183
GlaI GCGC 1 cut(s) 45
HhaI GCGC 1 cut(s) 46
Hin1II CATG 2 cut(s) 50, 187
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 109
Hpy99I CGWCG 2 cut(s) 63, 113
HpyCH4III ACNGT 2 cut(s) 77, 113
Hsp92II CATG 2 cut(s) 50, 187
HspAI GCGC 1 cut(s) 44
Kzo9I GATC 4 cut(s) 8, 119, 123, 177
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 5 cut(s) 39, 115, 118, 128, 186
MaeIII GTNAC 2 cut(s) 91, 218
MalI GATC 4 cut(s) 10, 121, 125, 179
MboI GATC 4 cut(s) 8, 119, 123, 177
MflI RGATCY 1 cut(s) 8
MluCI AATT 3 cut(s) 163, 172, 223
MmeI TCCRAC 3 cut(s) 10, 49, 132
MnlI CCTC 2 cut(s) 34, 56
NdeII GATC 4 cut(s) 8, 119, 123, 177
NlaIII CATG 2 cut(s) 50, 187
NmuCI GTSAC 1 cut(s) 91
NspI RCATGY 1 cut(s) 50
PaeI GCATGC 1 cut(s) 50
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PflMI CCANNNNNTGG 1 cut(s) 189
PpuMI RGGWCCY 1 cut(s) 203
Psp5II RGGWCCY 1 cut(s) 203
PspPI GGNCC 1 cut(s) 203
PspPPI RGGWCCY 1 cut(s) 203
PsuI RGATCY 1 cut(s) 8
Sau3AI GATC 4 cut(s) 8, 119, 123, 177
Sau96I GGNCC 1 cut(s) 203
SetI ASST 3 cut(s) 107, 137, 205
SinI GGWCC 1 cut(s) 203
SphI GCATGC 1 cut(s) 50
Sse9I AATT 3 cut(s) 163, 172, 223
SsiI CCGC 1 cut(s) 38
StyI CCWWGG 1 cut(s) 211
TaaI ACNGT 2 cut(s) 77, 113
TaqI TCGA 1 cut(s) 122
TasI AATT 3 cut(s) 163, 172, 223
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspGWI ACGGA 1 cut(s) 116
Van91I CCANNNNNTGG 1 cut(s) 189
VpaK11BI GGWCC 1 cut(s) 203
XceI RCATGY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.