pycom05g00290

Acts as a sulfur carrier required for molybdopterin biosynthesis. Component of the molybdopterin synthase complex that catalyzes the conversion of precursor Z into molybdopterin by mediating the incorporation of 2 sulfur atoms into precursor Z to generate a dithiolene group. In the complex, serves as sulfur donor by being thiocarboxylated (-COSH) at its C-terminus by MOCS3. After interaction with MOCS2B, the sulfur is then transferred to precursor Z to form molybdopterin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0014109
Physical Location & Seq
Forward (+)
351560 .. 351877
318 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g00290.1

Sequence Viewer

Length: 318 bp
ATGGATTTCAAACAAGAAGAGAGTAAGACGGTAACCATGGACTCTACCAGTCAGGGGATCGAGGGTTCATCTGTTAAGATAAAGGTGTTGTTCTTTGCCAGGGCTCGTGGTCTAACTGGCTTGAGTGATATGCCACTGGAGGTGTCCTCTGGTAGTACTGCCCTTGATTGTTTAGATAAGCTCATTGCCATGTTTCCAAGCTTGACAGAGATCCGAGGATGCATGGTGCTTGCTCTTAATGAGGCGTACACAGCTGATTCTGCAGTCGTTAAAGACAAGGATGAGTTGGCCATAATACCTCCGATAAGTGGTGGCTGA

Protein Analysis

106

Amino Acids

11.16

Weight (kDa)

4.56

Isoelectric Point (pI)

38.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ThiS PF02597 29 - 105 8.6e-13 ThiS family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014109)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G10100 AT4G10100 AT4G10100
fragaria_vesca FvH4_2g00750
malus_domestica MD05G1003200.v1.1 MD10G1004200.v1.1
prunus_persica Prupe.8G006600_v2.0.a1
pyrus_communis pycom05g00290
rosa_chinensis RchiOBHm_Chr6g0251131
rosa_laevigata RLG00000015481
rosa_roxburghii Rroxscaffold_7G00217010
rosa_rugosa Rorug05G0500600
rosa_samantha Rh6AG009500 Rh6BG002400 Rh6CG006300 Rh6DG006600
rosa_wichuraiana Rw6G000950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 65, 205
AcoI YGGCCR 1 cut(s) 288
AfaI GTAC 2 cut(s) 157, 248
AfiI CCNNNNNNNGG 2 cut(s) 54, 308
AgsI TTSAA 1 cut(s) 10
AjnI CCWGG 1 cut(s) 98
AloI GAACNNNNNNTCC 2 cut(s) 49, 81
AluBI AGCT 3 cut(s) 181, 201, 254
AluI AGCT 3 cut(s) 181, 201, 254
AlwI GGATC 2 cut(s) 65, 205
AoxI GGCC 1 cut(s) 288
BalI TGGCCA 1 cut(s) 290
BanII GRGCYC 1 cut(s) 106
BauI CACGAG 1 cut(s) 105
BciT130I CCWGG 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 261
BmcAI AGTACT 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BmsI GCATC 1 cut(s) 209
BplI GAGNNNNNCTC 2 cut(s) 131, 163
BpmI CTGGAG 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 142
BsaJI CCNNGG 3 cut(s) 36, 99, 214
Bsc4I CCNNNNNNNGG 2 cut(s) 54, 308
Bse1I ACTGG 3 cut(s) 48, 121, 141
Bse3DI GCAATG 1 cut(s) 183
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 3 cut(s) 36, 99, 214
BseGI GGATG 2 cut(s) 224, 286
BseLI CCNNNNNNNGG 2 cut(s) 54, 308
BseMI GCAATG 1 cut(s) 183
BseNI ACTGG 3 cut(s) 48, 121, 141
BshFI GGCC 1 cut(s) 290
BslI CCNNNNNNNGG 2 cut(s) 54, 308
BsnI GGCC 1 cut(s) 290
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 57, 210
Bsp19I CCATGG 1 cut(s) 36
BspANI GGCC 1 cut(s) 290
BspMAI CTGCAG 1 cut(s) 265
BspPI GGATC 2 cut(s) 65, 205
BsrDI GCAATG 1 cut(s) 183
BsrI ACTGG 3 cut(s) 48, 121, 141
BssECI CCNNGG 3 cut(s) 36, 99, 214
BssMI GATC 2 cut(s) 57, 210
BssSI CACGAG 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 36
Bst2BI CACGAG 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 100
Bst4CI ACNGT 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 231
BstDSI CCRYGG 1 cut(s) 36
BstEII GGTNACC 1 cut(s) 31
BstF5I GGATG 2 cut(s) 224, 286
BstKTI GATC 2 cut(s) 60, 213
BstMBI GATC 2 cut(s) 57, 210
BstMWI GCNNNNNNNGC 2 cut(s) 251, 260
BstNI CCWGG 1 cut(s) 100
BstPI GGTNACC 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 98
BstSFI CTRYAG 1 cut(s) 261
BstX2I RGATCY 1 cut(s) 210
BstYI RGATCY 1 cut(s) 210
BsuRI GGCC 1 cut(s) 290
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 2 cut(s) 224, 286
BtsIMutI CAGTG 1 cut(s) 134
Cac8I GCNNGC 1 cut(s) 231
Csp6I GTAC 2 cut(s) 156, 247
CviAII CATG 3 cut(s) 37, 190, 223
CviJI RGCY 7 cut(s) 104, 120, 181, 201, 254, 290, 315
CviKI_1 RGCY 7 cut(s) 104, 120, 181, 201, 254, 290, 315
CviQI GTAC 2 cut(s) 156, 247
DpnI GATC 2 cut(s) 59, 212
DpnII GATC 2 cut(s) 57, 210
EaeI YGGCCR 1 cut(s) 288
Eam1104I CTCTTC 1 cut(s) 12
EarI CTCTTC 1 cut(s) 12
Eco130I CCWWGG 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 106
Eco91I GGTNACC 1 cut(s) 31
EcoO65I GGTNACC 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 36
EcoT22I ATGCAT 1 cut(s) 224
EcoT38I GRGCYC 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 3 cut(s) 40, 193, 226
FaiI YATR 5 cut(s) 38, 131, 191, 224, 293
FatI CATG 3 cut(s) 36, 189, 222
FokI GGATG 2 cut(s) 231, 293
FriOI GRGCYC 1 cut(s) 106
GsuI CTGGAG 1 cut(s) 158
HaeIII GGCC 1 cut(s) 290
Hin1II CATG 3 cut(s) 40, 193, 226
HindIII AAGCTT 1 cut(s) 199
HinfI GANTC 2 cut(s) 41, 257
Hpy166II GTNNAC 1 cut(s) 249
Hpy188I TCNGA 2 cut(s) 215, 303
Hpy8I GTNNAC 1 cut(s) 249
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 222, 263
HpyF10VI GCNNNNNNNGC 2 cut(s) 251, 260
Hsp92II CATG 3 cut(s) 40, 193, 226
Kzo9I GATC 2 cut(s) 57, 210
LpnPI CCDG 7 cut(s) 38, 61, 85, 102, 112, 122, 135
LweI GCATC 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 31
MalI GATC 2 cut(s) 59, 212
MboI GATC 2 cut(s) 57, 210
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 210
MhlI GDGCHC 1 cut(s) 106
MlsI TGGCCA 1 cut(s) 290
MluNI TGGCCA 1 cut(s) 290
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 6 cut(s) 55, 133, 157, 209, 235, 309
Mox20I TGGCCA 1 cut(s) 290
Mph1103I ATGCAT 1 cut(s) 224
MscI TGGCCA 1 cut(s) 290
MseI TTAA 3 cut(s) 75, 237, 270
MslI CAYNNNNRTG 1 cut(s) 188
Msp20I TGGCCA 1 cut(s) 290
MspA1I CMGCKG 1 cut(s) 254
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
MwoI GCNNNNNNNGC 2 cut(s) 251, 260
NcoI CCATGG 1 cut(s) 36
NdeII GATC 2 cut(s) 57, 210
NlaIII CATG 3 cut(s) 40, 193, 226
NsiI ATGCAT 1 cut(s) 224
PfeI GAWTC 1 cut(s) 257
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 98
PspEI GGTNACC 1 cut(s) 31
PspGI CCWGG 1 cut(s) 98
PstI CTGCAG 1 cut(s) 265
PsuI RGATCY 1 cut(s) 210
PvuII CAGCTG 1 cut(s) 254
RsaI GTAC 2 cut(s) 157, 248
RsaNI GTAC 2 cut(s) 156, 247
RseI CAYNNNNRTG 1 cut(s) 188
SaqAI TTAA 3 cut(s) 75, 237, 270
Sau3AI GATC 2 cut(s) 57, 210
ScaI AGTACT 1 cut(s) 157
SchI GAGTC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 100
SduI GDGCHC 1 cut(s) 106
SetI ASST 6 cut(s) 87, 144, 183, 203, 256, 301
SfaNI GCATC 1 cut(s) 209
SfcI CTRYAG 1 cut(s) 261
SmiMI CAYNNNNRTG 1 cut(s) 188
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 60
TatI WGTACW 1 cut(s) 155
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 3 cut(s) 75, 237, 270
Tru9I TTAA 3 cut(s) 75, 237, 270
TscAI CASTG 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 1 cut(s) 141
ZrmI AGTACT 1 cut(s) 157
Zsp2I ATGCAT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.