pycom07g15700

L-threonine ammonia-lyase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
18223064 .. 18223429
366 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g15700.1

Sequence Viewer

Length: 366 bp
ATGTCATCACCTAAGGTTCTCGCCTTATTTGATTTCTCCAAACCTTTTACCATCAAAATTGATGCTTCAGGGATCGGTATTGGTGTAGTTATTCAACAAGATGGGAGACCGATTCCATTCATGAGTAAAGCTTTGGGGCCTAGAAACCATTTTATTGAAGTAGATGTTTTATGTGCTGTGAAGAAATGGCAATCATATTTGGCTAGAAACCATTTTATCATCAAGATAGATTATCATAGTTTGAAGTATTTCTTCCAAAATAAAGCTCATATGCCTTTTCAACAAAAGTGGGTGTCTAAGTTGCTAGGTTTTGATCATGAGATTGTTTACAGAGAGGTTAGAGATCAAATGGCAGATGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

14.05

Weight (kDa)

9.44

Isoelectric Point (pI)

37.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RT_RNaseH_2 PF17919 2 - 74 4.5e-11 RNase H-like domain found in reverse transcriptase
RT_RNaseH PF17917 11 - 104 7.4e-17 RNase H-like domain found in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019119)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 51
AgsI TTSAA 4 cut(s) 95, 158, 244, 281
AluBI AGCT 2 cut(s) 131, 266
AluI AGCT 2 cut(s) 131, 266
Alw26I GTCTC 1 cut(s) 100
AlwI GGATC 1 cut(s) 80
AoxI GGCC 1 cut(s) 137
Asp700I GAANNNNTTC 1 cut(s) 248
AspS9I GGNCC 1 cut(s) 137
AxyI CCTNAGG 1 cut(s) 12
BccI CCATC 2 cut(s) 59, 95
BclI TGATCA 1 cut(s) 313
BcoDI GTCTC 1 cut(s) 100
BfaI CTAG 3 cut(s) 141, 204, 305
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 138
BmsI GCATC 2 cut(s) 52, 346
BsaI GGTCTC 1 cut(s) 100
Bse21I CCTNAGG 1 cut(s) 12
BshFI GGCC 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 100
BsnI GGCC 1 cut(s) 139
Bso31I GGTCTC 1 cut(s) 100
Bsp143I GATC 3 cut(s) 72, 313, 343
BspANI GGCC 1 cut(s) 139
BspHI TCATGA 2 cut(s) 120, 316
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 1 cut(s) 80
BspTNI GGTCTC 1 cut(s) 100
BssMI GATC 3 cut(s) 72, 313, 343
BstDEI CTNAG 2 cut(s) 12, 297
BstKTI GATC 3 cut(s) 75, 316, 346
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 3 cut(s) 72, 313, 343
Bsu36I CCTNAGG 1 cut(s) 12
BsuRI GGCC 1 cut(s) 139
CciI TCATGA 2 cut(s) 120, 316
Cfr13I GGNCC 1 cut(s) 137
CspCI CAANNNNNGTGG 2 cut(s) 269, 304
CviAII CATG 2 cut(s) 121, 317
CviJI RGCY 4 cut(s) 131, 139, 203, 266
CviKI_1 RGCY 4 cut(s) 131, 139, 203, 266
DdeI CTNAG 2 cut(s) 12, 297
DpnI GATC 3 cut(s) 74, 315, 345
DpnII GATC 3 cut(s) 72, 313, 343
Eco31I GGTCTC 1 cut(s) 100
Eco57I CTGAAG 1 cut(s) 51
Eco81I CCTNAGG 1 cut(s) 12
EcoO109I RGGNCCY 1 cut(s) 137
FaeI CATG 2 cut(s) 124, 320
FaiI YATR 7 cut(s) 122, 172, 196, 237, 270, 272, 318
FalI AAGNNNNNCTT 2 cut(s) 236, 268
FatI CATG 2 cut(s) 120, 316
FauNDI CATATG 1 cut(s) 270
FbaI TGATCA 1 cut(s) 313
FspBI CTAG 3 cut(s) 141, 204, 305
HaeIII GGCC 1 cut(s) 139
Hin1II CATG 2 cut(s) 124, 320
HindIII AAGCTT 1 cut(s) 129
HinfI GANTC 1 cut(s) 112
Hpy166II GTNNAC 1 cut(s) 328
Hpy188III TCNNGA 3 cut(s) 121, 223, 317
Hpy8I GTNNAC 1 cut(s) 328
HpyF3I CTNAG 2 cut(s) 12, 297
Hsp92II CATG 2 cut(s) 124, 320
Ksp22I TGATCA 1 cut(s) 313
Kzo9I GATC 3 cut(s) 72, 313, 343
LpnPI CCDG 1 cut(s) 54
LweI GCATC 2 cut(s) 52, 346
MaeI CTAG 3 cut(s) 141, 204, 305
MalI GATC 3 cut(s) 74, 315, 345
MboI GATC 3 cut(s) 72, 313, 343
MboII GAAGA 2 cut(s) 193, 244
MluCI AATT 1 cut(s) 57
MnlI CCTC 1 cut(s) 328
MroXI GAANNNNTTC 1 cut(s) 248
NdeI CATATG 1 cut(s) 270
NdeII GATC 3 cut(s) 72, 313, 343
NlaIII CATG 2 cut(s) 124, 320
NlaIV GGNNCC 1 cut(s) 138
PagI TCATGA 2 cut(s) 120, 316
PdmI GAANNNNTTC 1 cut(s) 248
PfeI GAWTC 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 138
PspPI GGNCC 1 cut(s) 137
Sau3AI GATC 3 cut(s) 72, 313, 343
Sau96I GGNCC 1 cut(s) 137
SetI ASST 7 cut(s) 13, 18, 46, 133, 268, 310, 339
SfaNI GCATC 2 cut(s) 52, 346
SgeI CNNG 9 cut(s) 32, 81, 110, 133, 153, 216, 235, 317, 329
Sse9I AATT 1 cut(s) 57
SspMI CTAG 3 cut(s) 141, 204, 305
TaqII GACCGA 1 cut(s) 124
TasI AATT 1 cut(s) 57
TfiI GAWTC 1 cut(s) 112
TspDTI ATGAA 1 cut(s) 109
XmnI GAANNNNTTC 1 cut(s) 248
XspI CTAG 3 cut(s) 141, 204, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.