pycom09g02060

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
1495449 .. 1496781
1333 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g02060.2

Sequence Viewer

Length: 249 bp
ATGGCAGAGTCCAGACCATATGCTTGCTGGTGGGATAGTCACGTTTCAAGGAATTCAAAACGGCTTCAGGAGAATCTTACAGGGAGTGGAATTTTGGTCTCTGCAAGATTTTTGGGCTTTGAAATGGCTCAAACCAGGAGCAAGTCTAGTATCCAAGCTCTGCATTCGTTGCATGTAGCACATGAAAAGTCTAAGTATGTAGTAAGCTTTATTTGGCAGGTATTCCCTCAATATTACATTTATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.57

Weight (kDa)

9.52

Isoelectric Point (pI)

58.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018906)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 243
Acc36I ACCTGC 1 cut(s) 208
AcsI RAATTY 2 cut(s) 52, 90
AcuI CTGAAG 1 cut(s) 50
AgsI TTSAA 3 cut(s) 48, 57, 122
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 2 cut(s) 158, 207
AluI AGCT 2 cut(s) 158, 207
Alw26I GTCTC 1 cut(s) 103
ApoI RAATTY 2 cut(s) 52, 90
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 136
BciVI GTATCC 1 cut(s) 161
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 147
BfuAI ACCTGC 1 cut(s) 208
BfuI GTATCC 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 136
BsaI GGTCTC 1 cut(s) 103
BseBI CCWGG 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 103
BsmI GAATGC 1 cut(s) 163
Bso31I GGTCTC 1 cut(s) 103
BspMI ACCTGC 1 cut(s) 208
BspTNI GGTCTC 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 136
BstAPI GCANNNNNTGC 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 192
BstMAI GTCTC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNI CCWGG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 134
BsuI GTATCC 1 cut(s) 161
BveI ACCTGC 1 cut(s) 208
Cac8I GCNNGC 1 cut(s) 25
CviAII CATG 2 cut(s) 173, 182
CviJI RGCY 5 cut(s) 64, 117, 128, 158, 207
CviKI_1 RGCY 5 cut(s) 64, 117, 128, 158, 207
DdeI CTNAG 1 cut(s) 192
Eco31I GGTCTC 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 50
EcoRI GAATTC 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 134
FaeI CATG 2 cut(s) 176, 185
FaiI YATR 6 cut(s) 19, 21, 174, 183, 198, 243
FatI CATG 2 cut(s) 172, 181
FauNDI CATATG 1 cut(s) 19
FspBI CTAG 1 cut(s) 147
Hin1II CATG 2 cut(s) 176, 185
HindIII AAGCTT 1 cut(s) 205
HinfI GANTC 2 cut(s) 8, 73
Hpy188III TCNNGA 2 cut(s) 12, 68
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 104, 163, 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 192
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 2 cut(s) 176, 185
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 7 cut(s) 13, 25, 53, 66, 121, 148, 203
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 38
MluCI AATT 3 cut(s) 52, 90, 244
MlyI GAGTC 1 cut(s) 17
MnlI CCTC 1 cut(s) 237
MspR9I CCNGG 1 cut(s) 136
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 1 cut(s) 136
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeI CATATG 1 cut(s) 19
NlaIII CATG 2 cut(s) 176, 185
NmuCI GTSAC 1 cut(s) 38
NspI RCATGY 1 cut(s) 176
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 73
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PsiI TTATAA 1 cut(s) 243
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
SchI GAGTC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 136
SetI ASST 4 cut(s) 45, 160, 209, 222
Sse9I AATT 3 cut(s) 52, 90, 244
SspI AATATT 1 cut(s) 233
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 134
TaiI ACGT 1 cut(s) 45
TasI AATT 3 cut(s) 52, 90, 244
TfiI GAWTC 1 cut(s) 73
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 198
XapI RAATTY 2 cut(s) 52, 90
XceI RCATGY 1 cut(s) 176
XcmI CCANNNNNNNNNTGG 1 cut(s) 24
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.