RchiOBHm_Chr7g0222401

RING-type E3 ubiquitin transferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
43726186 .. 43726904
719 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19905

Sequence Viewer

Length: 138 bp
ATGGATAGTCTCAGGCGTGATGAAGATATTGTTTCACAATCTATTGGTTGTCAGATTCAAGAGGTTCTTAGTGAACTTGAGTGTACTGTACTGTCTTCGCACTTGATCCCTCAGAGAAGCCAGTTGGTGATGACATAA

Protein Analysis

45

Amino Acids

5.09

Weight (kDa)

4.43

Isoelectric Point (pI)

92.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018906)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 100
AfaI GTAC 2 cut(s) 85, 90
AgsI TTSAA 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 14
AlwI GGATC 1 cut(s) 100
BbsI GAAGAC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 14
BpiI GAAGAC 1 cut(s) 87
BpuEI CTTGAG 1 cut(s) 98
Bse1I ACTGG 1 cut(s) 121
BseMII CTCAG 2 cut(s) 25, 125
BseNI ACTGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 105
BspCNI CTCAG 2 cut(s) 24, 124
BspPI GGATC 1 cut(s) 100
BsrI ACTGG 1 cut(s) 121
BssMI GATC 1 cut(s) 105
Bst4CI ACNGT 2 cut(s) 88, 93
BstDEI CTNAG 3 cut(s) 11, 68, 111
BstKTI GATC 1 cut(s) 108
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 87
Csp6I GTAC 2 cut(s) 84, 89
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
CviQI GTAC 2 cut(s) 84, 89
DdeI CTNAG 3 cut(s) 11, 68, 111
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
FaiI YATR 1 cut(s) 136
FalI AAGNNNNNCTT 2 cut(s) 51, 83
FspEI CC 6 cut(s) 30, 47, 110, 122, 123, 134
HinfI GANTC 1 cut(s) 55
Hpy166II GTNNAC 2 cut(s) 74, 84
Hpy188I TCNGA 2 cut(s) 54, 114
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 2 cut(s) 74, 84
HpyCH4III ACNGT 2 cut(s) 88, 93
HpyF3I CTNAG 3 cut(s) 11, 68, 111
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 1 cut(s) 134
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 2 cut(s) 35, 87
MnlI CCTC 2 cut(s) 55, 120
NdeII GATC 1 cut(s) 105
PfeI GAWTC 1 cut(s) 55
RsaI GTAC 2 cut(s) 85, 90
RsaNI GTAC 2 cut(s) 84, 89
Sau3AI GATC 1 cut(s) 105
SetI ASST 1 cut(s) 66
SgeI CNNG 6 cut(s) 25, 29, 71, 89, 115, 133
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
TaaI ACNGT 2 cut(s) 88, 93
TatI WGTACW 2 cut(s) 83, 88
TfiI GAWTC 1 cut(s) 55
TspDTI ATGAA 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.