Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7B

Orthogroup ID

OG0018906

Physical Location & Seq

Genomic Coordinates Reverse (-)

35573566 .. 35574523

Gene Structure 958 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7BG340800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

ATGCCAAGGTATGAAGGAGATACGGATGCATGGAGAAATGTGCAAGACACGCTCTCTGCAATTTATTGCAAAGTAATGTCAATATTTCCTTCCTTGGAAGCGGCTCGGCCTAGGAGCAAATCTGGCATCCAAGCTTTATGTTCATTGCATGTAGGGCTTGAAAAAGCGAAGAATGTGCTTCAACACTGTTCTGAATGTAGTAAACTCTACCTGGCTATAAATGGGGATTTTGTGCTCTCGAAATTTGAGAAGGCAAGAAGTGCTCTCATGGATAGTCTCAGGCGTGCTGAAGATATTGTTCCACAATCTATTGGTTGTCAGGTAGTTGTTCTTCAAATTCCATGTGAGCATTTCCTGGGGGCTGGTTATCCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004842 GO:0005102 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009507 GO:0009536 GO:0009987 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0032446 GO:0033612 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0070647 GO:0070696 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

KAP U-box

Protein Analysis

124

Amino Acids

13.73

Weight (kDa)

7.6

Isoelectric Point (pI)

43.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018906)

Species	Orthologous Gene IDs
malus_domestica	MD05G1035700.v1.1
pyrus_communis	pycom07g05700 pycom09g02060 pycom16g09840 pycom16g09900
rosa_chinensis	RchiOBHm_Chr2g0111811 RchiOBHm_Chr7g0222401
rosa_samantha	Rh1AG036700 Rh7BG340800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	101
AcsI	RAATTY	2 cut(s)	242, 336
AcuI	CTGAAG	1 cut(s)	309
AgsI	TTSAA	3 cut(s)	161, 182, 335
AjnI	CCWGG	2 cut(s)	210, 354
AluBI	AGCT	1 cut(s)	134
AluI	AGCT	1 cut(s)	134
Alw21I	GWGCWC	2 cut(s)	237, 265
Alw26I	GTCTC	1 cut(s)	281
AoxI	GGCC	1 cut(s)	107
ApoI	RAATTY	2 cut(s)	242, 336
AspA2I	CCTAGG	1 cut(s)	110
AvrII	CCTAGG	1 cut(s)	110
BarI	GAAGNNNNNNTAC	2 cut(s)	315, 347
Bbv12I	GWGCWC	2 cut(s)	237, 265
BcgI	CGANNNNNNTGC	2 cut(s)	157, 191
BciT130I	CCWGG	2 cut(s)	212, 356
BcoDI	GTCTC	1 cut(s)	281
BfaI	CTAG	1 cut(s)	111
BisI	GCNGC	1 cut(s)	102
BlnI	CCTAGG	1 cut(s)	110
BlsI	GCNGC	1 cut(s)	103
Bme1390I	CCNGG	2 cut(s)	212, 356
BmrFI	CCNGG	2 cut(s)	212, 356
BmsI	GCATC	2 cut(s)	16, 135
BsaJI	CCNNGG	4 cut(s)	5, 93, 110, 355
Bse3DI	GCAATG	1 cut(s)	143
BseBI	CCWGG	2 cut(s)	212, 356
BseDI	CCNNGG	4 cut(s)	5, 93, 110, 355
BseGI	GGATG	2 cut(s)	31, 126
BseMI	GCAATG	1 cut(s)	143
BseMII	CTCAG	1 cut(s)	292
BshFI	GGCC	1 cut(s)	109
BsiHKAI	GWGCWC	2 cut(s)	237, 265
BsmAI	GTCTC	1 cut(s)	281
BsnI	GGCC	1 cut(s)	109
Bsp1286I	GDGCHC	2 cut(s)	237, 265
BspACI	CCGC	1 cut(s)	101
BspANI	GGCC	1 cut(s)	109
BspCNI	CTCAG	1 cut(s)	291
BsrDI	GCAATG	1 cut(s)	143
BssECI	CCNNGG	4 cut(s)	5, 93, 110, 355
BssT1I	CCWWGG	3 cut(s)	5, 93, 110
Bst2UI	CCWGG	2 cut(s)	212, 356
Bst4CI	ACNGT	1 cut(s)	188
BstAPI	GCANNNNNTGC	1 cut(s)	260
BstC8I	GCNNGC	1 cut(s)	285
BstDEI	CTNAG	1 cut(s)	278
BstF5I	GGATG	2 cut(s)	31, 126
BstMAI	GTCTC	1 cut(s)	281
BstMWI	GCNNNNNNNGC	4 cut(s)	49, 123, 154, 260
BstNI	CCWGG	2 cut(s)	212, 356
BstNSI	RCATGY	1 cut(s)	152
BstSCI	CCNGG	2 cut(s)	210, 354
BsuRI	GGCC	1 cut(s)	109
BtsCI	GGATG	2 cut(s)	31, 126
BtsIMutI	CAGTG	1 cut(s)	184
Cac8I	GCNNGC	1 cut(s)	285
CviAII	CATG	4 cut(s)	30, 149, 268, 342
CviJI	RGCY	6 cut(s)	104, 109, 134, 157, 215, 362
CviKI_1	RGCY	6 cut(s)	104, 109, 134, 157, 215, 362
DdeI	CTNAG	1 cut(s)	278
Eco130I	CCWWGG	3 cut(s)	5, 93, 110
Eco57I	CTGAAG	1 cut(s)	309
EcoRII	CCWGG	2 cut(s)	210, 354
EcoT14I	CCWWGG	3 cut(s)	5, 93, 110
EcoT22I	ATGCAT	1 cut(s)	31
ErhI	CCWWGG	3 cut(s)	5, 93, 110
FaeI	CATG	4 cut(s)	33, 152, 271, 345
FaiI	YATR	8 cut(s)	12, 31, 139, 150, 218, 269, 343, 373
FatI	CATG	4 cut(s)	29, 148, 267, 341
Fnu4HI	GCNGC	1 cut(s)	102
FokI	GGATG	2 cut(s)	38, 113
Fsp4HI	GCNGC	1 cut(s)	102
FspBI	CTAG	1 cut(s)	111
GluI	GCNGC	1 cut(s)	102
HaeIII	GGCC	1 cut(s)	109
Hin1II	CATG	4 cut(s)	33, 152, 271, 345
HindIII	AAGCTT	1 cut(s)	132
Hpy166II	GTNNAC	1 cut(s)	203
Hpy188I	TCNGA	1 cut(s)	193
Hpy188III	TCNNGA	1 cut(s)	238
Hpy8I	GTNNAC	1 cut(s)	203
HpyAV	CCTTC	3 cut(s)	8, 99, 244
HpyCH4III	ACNGT	1 cut(s)	188
HpyCH4V	TGCA	5 cut(s)	29, 43, 59, 69, 148
HpyF10VI	GCNNNNNNNGC	4 cut(s)	49, 123, 154, 260
HpyF3I	CTNAG	1 cut(s)	278
Hsp92II	CATG	4 cut(s)	33, 152, 271, 345
LmnI	GCTCC	1 cut(s)	114
LpnPI	CCDG	8 cut(s)	108, 197, 224, 265, 305, 341, 348, 368
LweI	GCATC	2 cut(s)	16, 135
MaeI	CTAG	1 cut(s)	111
MboII	GAAGA	3 cut(s)	181, 302, 323
MhlI	GDGCHC	2 cut(s)	237, 265
MluCI	AATT	3 cut(s)	60, 242, 336
Mph1103I	ATGCAT	1 cut(s)	31
MspR9I	CCNGG	2 cut(s)	212, 356
MvaI	CCWGG	2 cut(s)	212, 356
MwoI	GCNNNNNNNGC	4 cut(s)	49, 123, 154, 260
NlaIII	CATG	4 cut(s)	33, 152, 271, 345
NmeAIII	GCCGAG	1 cut(s)	85
NsiI	ATGCAT	1 cut(s)	31
NspI	RCATGY	1 cut(s)	152
PkrI	GCNGC	1 cut(s)	103
Psp6I	CCWGG	2 cut(s)	210, 354
PspGI	CCWGG	2 cut(s)	210, 354
SatI	GCNGC	1 cut(s)	102
ScrFI	CCNGG	2 cut(s)	212, 356
SduI	GDGCHC	2 cut(s)	237, 265
SetI	ASST	4 cut(s)	11, 136, 213, 324
SfaNI	GCATC	2 cut(s)	16, 135
Sse9I	AATT	3 cut(s)	60, 242, 336
SsiI	CCGC	1 cut(s)	101
SspI	AATATT	1 cut(s)	84
SspMI	CTAG	1 cut(s)	111
StyD4I	CCNGG	2 cut(s)	210, 354
StyI	CCWWGG	3 cut(s)	5, 93, 110
TaaI	ACNGT	1 cut(s)	188
TaqI	TCGA	1 cut(s)	239
TasI	AATT	3 cut(s)	60, 242, 336
TauI	GCSGC	1 cut(s)	104
TscAI	CASTG	1 cut(s)	191
TspDTI	ATGAA	2 cut(s)	27, 132
TspGWI	ACGGA	1 cut(s)	38
TspRI	CASTG	1 cut(s)	191
XapI	RAATTY	2 cut(s)	242, 336
XceI	RCATGY	1 cut(s)	152
XmaJI	CCTAGG	1 cut(s)	110
XspI	CTAG	1 cut(s)	111
Zsp2I	ATGCAT	1 cut(s)	31

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.