Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr11

Orthogroup ID

OG0008980

Physical Location & Seq

Genomic Coordinates Forward (+)

7761853 .. 7764829

Gene Structure 2977 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 651 bp

ATGGCTGCTCCACCGGCGAGGGCTAGAGCCGATTACGATTACCTCATAAAGCTTCTGTTGATCGGCGACAGCGGTGTTGGTAAGAGTTGCCTTCTTTTGCGTTTCTCAGATGGTTCCTTCACCACTAGTTTCATAACAACCATTGGCATTGATTTCAAGATAAGGACCATTGAGCTTGATGGAAAACGAATTAAGCTCCAAATTTGGGACACAGCTGGTCAGGAGCGGTTCCGTACAATCACAACTGCTTACTATCGTGGAGCCATGGGCATTTTGCTGGTCTATGATGTAACCGATGAATCATCTTTCAATAACATAAGGAATTGGATTCGCAACATTGAACAGCATGCATCAGATAATGTTAACAAAATACTTGTAGGGAACAAGGCTGACATGGACGAAAGCAAACGGGCTGTGCCTACCTCCAAGGGCCAAGCACTTGCTGACGAATATGGGATCAAGTTCTTTGAAACTAGTGCAAAGACGAATCTTAATGTGGAGCAAGTTTTCTTTTCAATAGCAAGAGACATAAAGCAACGGCTTGCAGATACCGACACTAGGGCTGAGCCTACCACAATCAAGATCAACCAACCTGACCAGGGAGCCGGGGGCGGTCAAGCTGCACAAAGATCAGCTTGCTGCGGTTCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04144 ko04152 ko04530 ko04972 map04144 map04152 map04530 map04972

Pfam Domains

Protein Families

Ras

Protein Analysis

217

Amino Acids

23.87

Weight (kDa)

8.39

Isoelectric Point (pI)

34.77

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	16 - 143	5.4e-15	ADP-ribosylation factor family
Ras	PF00071	17 - 178	3.1e-68	Ras family
Roc	PF08477	17 - 131	5.8e-35	Ras of Complex, Roc, domain of DAPkinase
GTP_EFTU	PF00009	49 - 173	8.1e-07	Elongation factor Tu GTP binding domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008980)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G09900 AT5G03520
fragaria_vesca	FvH4_3g35090
malus_domestica	MD03G1099100.v1.1 MD11G1113000.v1.1
prunus_persica	Prupe.6G083700_v2.0.a1 Prupe.6G083700_v2.0.a1 Prupe.6G083700_v2.0.a1 Prupe.6G083700_v2.0.a1
pyrus_communis	pycom03g08140 pycom11g09530
rosa_chinensis	RchiOBHm_Chr5g0063091
rosa_laevigata	RLG00000035603
rosa_multiflora	Rmu_sc0005045.1_g000040
rosa_roxburghii	Rroxscaffold_1G00017560
rosa_rugosa	Rorug05G0354200 Rorug05G0354200
rosa_samantha	Rh5AG414700 Rh5BG429600 Rh5CG453000 Rh5DG443100
rosa_wichuraiana	Rw5G038970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	226
AciI	CCGC	4 cut(s)	72, 226, 612, 642
AclWI	GGATC	1 cut(s)	464
AcsI	RAATTY	1 cut(s)	201
AfaI	GTAC	1 cut(s)	235
AfiI	CCNNNNNNNGG	3 cut(s)	205, 558, 599
AgsI	TTSAA	5 cut(s)	157, 310, 341, 470, 516
AhlI	ACTAGT	2 cut(s)	125, 473
AjnI	CCWGG	1 cut(s)	597
AluBI	AGCT	6 cut(s)	52, 175, 196, 215, 620, 635
AluI	AGCT	6 cut(s)	52, 175, 196, 215, 620, 635
Alw26I	GTCTC	1 cut(s)	519
AlwI	GGATC	1 cut(s)	464
AoxI	GGCC	1 cut(s)	430
ApeKI	GCWGC	3 cut(s)	5, 620, 639
ApoI	RAATTY	1 cut(s)	201
AspS9I	GGNCC	2 cut(s)	165, 430
AsuC2I	CCSGG	1 cut(s)	607
AsuHPI	GGTGA	1 cut(s)	112
AvaII	GGWCC	1 cut(s)	165
BbvI	GCAGC	2 cut(s)	607, 626
BccI	CCATC	2 cut(s)	104, 173
BceAI	ACGGC	1 cut(s)	554
BciT130I	CCWGG	1 cut(s)	599
BcnI	CCSGG	1 cut(s)	607
BcoDI	GTCTC	1 cut(s)	519
BcuI	ACTAGT	2 cut(s)	125, 473
BfaI	CTAG	4 cut(s)	24, 126, 474, 558
BisI	GCNGC	3 cut(s)	6, 621, 640
BlpI	GCTNAGC	1 cut(s)	564
BlsI	GCNGC	3 cut(s)	7, 622, 641
Bme1390I	CCNGG	2 cut(s)	599, 607
Bme18I	GGWCC	1 cut(s)	165
BmgT120I	GGNCC	2 cut(s)	165, 430
BmiI	GGNNCC	4 cut(s)	115, 230, 262, 604
BmrFI	CCNGG	2 cut(s)	599, 607
BmsI	GCATC	1 cut(s)	359
Bpu1102I	GCTNAGC	1 cut(s)	564
BpuMI	CCSGG	1 cut(s)	607
BsaJI	CCNNGG	4 cut(s)	264, 426, 598, 606
Bsc4I	CCNNNNNNNGG	3 cut(s)	205, 558, 599
Bse118I	RCCGGY	1 cut(s)	13
BseBI	CCWGG	1 cut(s)	599
BseDI	CCNNGG	4 cut(s)	264, 426, 598, 606
BseLI	CCNNNNNNNGG	3 cut(s)	205, 558, 599
BseMII	CTCAG	2 cut(s)	120, 555
BseXI	GCAGC	2 cut(s)	607, 626
BsgI	GTGCAG	1 cut(s)	606
BshFI	GGCC	1 cut(s)	432
BsiSI	CCGG	2 cut(s)	14, 606
BslFI	GGGAC	1 cut(s)	221
BslI	CCNNNNNNNGG	3 cut(s)	205, 558, 599
BsmAI	GTCTC	1 cut(s)	519
BsmFI	GGGAC	1 cut(s)	221
BsnI	GGCC	1 cut(s)	432
Bsp143I	GATC	4 cut(s)	60, 456, 582, 629
Bsp1720I	GCTNAGC	1 cut(s)	564
Bsp19I	CCATGG	1 cut(s)	264
BspACI	CCGC	4 cut(s)	72, 226, 612, 642
BspANI	GGCC	1 cut(s)	432
BspCNI	CTCAG	2 cut(s)	119, 556
BspLI	GGNNCC	4 cut(s)	115, 230, 262, 604
BspPI	GGATC	1 cut(s)	464
BsrBI	CCGCTC	1 cut(s)	226
BsrFI	RCCGGY	1 cut(s)	13
BssAI	RCCGGY	1 cut(s)	13
BssECI	CCNNGG	4 cut(s)	264, 426, 598, 606
BssMI	GATC	4 cut(s)	60, 456, 582, 629
BssT1I	CCWWGG	2 cut(s)	264, 426
Bst2UI	CCWGG	1 cut(s)	599
BstC8I	GCNNGC	3 cut(s)	348, 543, 637
BstDEI	CTNAG	2 cut(s)	106, 564
BstDSI	CCRYGG	1 cut(s)	264
BstKTI	GATC	4 cut(s)	63, 459, 585, 632
BstMAI	GTCTC	1 cut(s)	519
BstMBI	GATC	4 cut(s)	60, 456, 582, 629
BstMWI	GCNNNNNNNGC	1 cut(s)	14
BstNI	CCWGG	1 cut(s)	599
BstNSI	RCATGY	1 cut(s)	350
BstSCI	CCNGG	2 cut(s)	597, 605
BstV1I	GCAGC	2 cut(s)	607, 626
BsuRI	GGCC	1 cut(s)	432
BtgI	CCRYGG	1 cut(s)	264
Cac8I	GCNNGC	3 cut(s)	348, 543, 637
Cfr10I	RCCGGY	1 cut(s)	13
Cfr13I	GGNCC	2 cut(s)	165, 430
Csp6I	GTAC	1 cut(s)	234
CviAII	CATG	3 cut(s)	265, 347, 394
CviQI	GTAC	1 cut(s)	234
DdeI	CTNAG	2 cut(s)	106, 564
DpnI	GATC	4 cut(s)	62, 458, 584, 631
DpnII	GATC	4 cut(s)	60, 456, 582, 629
Eco130I	CCWWGG	2 cut(s)	264, 426
Eco47I	GGWCC	1 cut(s)	165
EcoRII	CCWGG	1 cut(s)	597
EcoT14I	CCWWGG	2 cut(s)	264, 426
EcoT22I	ATGCAT	1 cut(s)	352
ErhI	CCWWGG	2 cut(s)	264, 426
FaeI	CATG	3 cut(s)	268, 350, 397
FaiI	YATR	9 cut(s)	47, 134, 266, 285, 317, 348, 395, 453, 530
FalI	AAGNNNNNCTT	2 cut(s)	619, 651
FaqI	GGGAC	1 cut(s)	221
FatI	CATG	3 cut(s)	264, 346, 393
Fnu4HI	GCNGC	3 cut(s)	6, 621, 640
Fsp4HI	GCNGC	3 cut(s)	6, 621, 640
FspBI	CTAG	4 cut(s)	24, 126, 474, 558
GluI	GCNGC	3 cut(s)	6, 621, 640
HaeIII	GGCC	1 cut(s)	432
HapII	CCGG	2 cut(s)	14, 606
Hin1II	CATG	3 cut(s)	268, 350, 397
HincII	GTYRAC	1 cut(s)	364
HindII	GTYRAC	1 cut(s)	364
HindIII	AAGCTT	1 cut(s)	50
HinfI	GANTC	3 cut(s)	299, 328, 487
HpaI	GTTAAC	1 cut(s)	364
HpaII	CCGG	2 cut(s)	14, 606
HphI	GGTGA	1 cut(s)	112
Hpy166II	GTNNAC	1 cut(s)	364
Hpy188I	TCNGA	2 cut(s)	109, 355
Hpy188III	TCNNGA	3 cut(s)	157, 221, 580
Hpy8I	GTNNAC	1 cut(s)	364
HpyAV	CCTTC	2 cut(s)	101, 127
HpyCH4V	TGCA	4 cut(s)	350, 479, 545, 623
HpyF10VI	GCNNNNNNNGC	1 cut(s)	14
HpyF3I	CTNAG	2 cut(s)	106, 564
Hsp92II	CATG	3 cut(s)	268, 350, 397
KspAI	GTTAAC	1 cut(s)	364
Kzo9I	GATC	4 cut(s)	60, 456, 582, 629
LmnI	GCTCC	6 cut(s)	13, 201, 223, 260, 499, 602
LpnPI	CCDG	8 cut(s)	27, 201, 206, 263, 584, 606, 611, 619
Lsp1109I	GCAGC	2 cut(s)	607, 626
LweI	GCATC	1 cut(s)	359
MaeI	CTAG	4 cut(s)	24, 126, 474, 558
MaeIII	GTNAC	1 cut(s)	289
MalI	GATC	4 cut(s)	62, 458, 584, 631
MbiI	CCGCTC	1 cut(s)	226
MboI	GATC	4 cut(s)	60, 456, 582, 629
MluCI	AATT	3 cut(s)	189, 201, 322
MnlI	CCTC	3 cut(s)	12, 53, 433
Mph1103I	ATGCAT	1 cut(s)	352
MseI	TTAA	4 cut(s)	192, 363, 492, 649
MspA1I	CMGCKG	2 cut(s)	72, 215
MspI	CCGG	2 cut(s)	14, 606
MspR9I	CCNGG	2 cut(s)	599, 607
MvaI	CCWGG	1 cut(s)	599
MwoI	GCNNNNNNNGC	1 cut(s)	14
NciI	CCSGG	1 cut(s)	607
NcoI	CCATGG	1 cut(s)	264
NdeII	GATC	4 cut(s)	60, 456, 582, 629
NlaIII	CATG	3 cut(s)	268, 350, 397
NlaIV	GGNNCC	4 cut(s)	115, 230, 262, 604
NsiI	ATGCAT	1 cut(s)	352
NspI	RCATGY	1 cut(s)	350
PaeI	GCATGC	1 cut(s)	350
PfeI	GAWTC	3 cut(s)	299, 328, 487
PkrI	GCNGC	3 cut(s)	7, 622, 641
Psp6I	CCWGG	1 cut(s)	597
PspGI	CCWGG	1 cut(s)	597
PspN4I	GGNNCC	4 cut(s)	115, 230, 262, 604
PspPI	GGNCC	2 cut(s)	165, 430
PvuII	CAGCTG	1 cut(s)	215
RsaI	GTAC	1 cut(s)	235
RsaNI	GTAC	1 cut(s)	234
SaqAI	TTAA	4 cut(s)	192, 363, 492, 649
SatI	GCNGC	3 cut(s)	6, 621, 640
Sau3AI	GATC	4 cut(s)	60, 456, 582, 629
Sau96I	GGNCC	2 cut(s)	165, 430
ScrFI	CCNGG	2 cut(s)	599, 607
SetI	ASST	9 cut(s)	45, 54, 177, 198, 217, 425, 595, 622, 637
SfaNI	GCATC	1 cut(s)	359
SgrAI	CRCCGGYG	1 cut(s)	13
SinI	GGWCC	1 cut(s)	165
SpeI	ACTAGT	2 cut(s)	125, 473
SphI	GCATGC	1 cut(s)	350
Sse9I	AATT	3 cut(s)	189, 201, 322
SsiI	CCGC	4 cut(s)	72, 226, 612, 642
SspMI	CTAG	4 cut(s)	24, 126, 474, 558
StyD4I	CCNGG	2 cut(s)	597, 605
StyI	CCWWGG	2 cut(s)	264, 426
TasI	AATT	3 cut(s)	189, 201, 322
TfiI	GAWTC	3 cut(s)	299, 328, 487
Tru1I	TTAA	4 cut(s)	192, 363, 492, 649
Tru9I	TTAA	4 cut(s)	192, 363, 492, 649
TseI	GCWGC	3 cut(s)	5, 620, 639
TspDTI	ATGAA	2 cut(s)	121, 312
TspGWI	ACGGA	1 cut(s)	221
VpaK11BI	GGWCC	1 cut(s)	165
XapI	RAATTY	1 cut(s)	201
XceI	RCATGY	1 cut(s)	350
XspI	CTAG	4 cut(s)	24, 126, 474, 558
Zsp2I	ATGCAT	1 cut(s)	352

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.