pycom15g18740

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
13298057 .. 13298453
397 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g18740.2

Sequence Viewer

Length: 354 bp
ATGAATGAAGGAGAGAGCATCTCCGACTATCACTCAAGGCTCATTGTGATAGTAAATCAGATGAGGAGAAATGGCGAGAGACTCGATAAAGTACGAGTTGTGGAGAAGATACTCCGGTCACTCACATCTAAGTTTGAGCATGTGGTGACTGCCATTGAGGAATCCAAGGATTTGGAGGCGATGAGCGCAGAGGAGCTACTAGGATCCCTCATAGTTCACGAGCAACGCATTCAGAAGAATGCAAGCCCCACAACGCTAGAGCAAGCTTTGGAGTCAAAGTTGAATATTGACAAACCAAATAAAGGTCGTGGGCAGTGGAACTCACGTCAGGTCGAGGCTATGCACAAAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

118

Amino Acids

13.41

Weight (kDa)

6.92

Isoelectric Point (pI)

53.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017871)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 198, 211
AfaI GTAC 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 302
AgsI TTSAA 1 cut(s) 283
AjiI CACGTC 1 cut(s) 326
AluBI AGCT 2 cut(s) 196, 266
AluI AGCT 2 cut(s) 196, 266
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 2 cut(s) 198, 211
AspLEI GCGC 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 157
BaeI ACNNNNGTAYC 2 cut(s) 101, 134
BamHI GGATCC 1 cut(s) 203
BauI CACGAG 1 cut(s) 218
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 2 cut(s) 200, 257
BmgBI CACGTC 1 cut(s) 326
BmiI GGNNCC 1 cut(s) 205
BmsI GCATC 1 cut(s) 27
BplI GAGNNNNNCTC 1 cut(s) 37
BpuEI CTTGAG 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 165
BsaWI WCCGGW 1 cut(s) 114
BsaXI ACNNNNNCTCC 2 cut(s) 263, 293
Bsc4I CCNNNNNNNGG 1 cut(s) 302
BseDI CCNNGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 302
BseRI GAGGAG 2 cut(s) 79, 206
BsiSI CCGG 1 cut(s) 115
BslI CCNNNNNNNGG 1 cut(s) 302
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 2 cut(s) 228, 244
Bsp143I GATC 1 cut(s) 203
BspLI GGNNCC 1 cut(s) 205
BspPI GGATC 2 cut(s) 198, 211
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 1 cut(s) 203
BssSI CACGAG 1 cut(s) 218
BssT1I CCWWGG 1 cut(s) 165
Bst2BI CACGAG 1 cut(s) 218
BstC8I GCNNGC 2 cut(s) 244, 264
BstDEI CTNAG 1 cut(s) 129
BstHHI GCGC 1 cut(s) 188
BstKTI GATC 1 cut(s) 206
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 203
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNSI RCATGY 1 cut(s) 143
BstX2I RGATCY 1 cut(s) 203
BstXI CCANNNNNNTGG 1 cut(s) 172
BstYI RGATCY 1 cut(s) 203
BtgZI GCGATG 1 cut(s) 194
BtrI CACGTC 1 cut(s) 326
BtsI GCAGTG 1 cut(s) 320
BtsIMutI CAGTG 1 cut(s) 320
Cac8I GCNNGC 2 cut(s) 244, 264
CfoI GCGC 1 cut(s) 188
Csp6I GTAC 1 cut(s) 92
CviAII CATG 1 cut(s) 140
CviJI RGCY 5 cut(s) 40, 196, 246, 266, 338
CviKI_1 RGCY 5 cut(s) 40, 196, 246, 266, 338
CviQI GTAC 1 cut(s) 92
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
Eco130I CCWWGG 1 cut(s) 165
EcoT14I CCWWGG 1 cut(s) 165
ErhI CCWWGG 1 cut(s) 165
FaeI CATG 1 cut(s) 143
FaiI YATR 3 cut(s) 141, 212, 341
FatI CATG 1 cut(s) 139
FspBI CTAG 2 cut(s) 200, 257
GlaI GCGC 1 cut(s) 187
HapII CCGG 1 cut(s) 115
HhaI GCGC 1 cut(s) 188
Hin1II CATG 1 cut(s) 143
Hin6I GCGC 1 cut(s) 186
HinP1I GCGC 1 cut(s) 186
HindIII AAGCTT 1 cut(s) 264
HinfI GANTC 3 cut(s) 81, 161, 272
HpaII CCGG 1 cut(s) 115
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 3 cut(s) 25, 60, 234
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 217
HpyCH4IV ACGT 1 cut(s) 325
HpyCH4V TGCA 2 cut(s) 242, 343
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
HpyF3I CTNAG 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 325
Hsp92II CATG 1 cut(s) 143
HspAI GCGC 1 cut(s) 186
Kzo9I GATC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 2 cut(s) 128, 314
LweI GCATC 1 cut(s) 27
MaeI CTAG 2 cut(s) 200, 257
MaeII ACGT 1 cut(s) 325
MaeIII GTNAC 2 cut(s) 117, 145
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 2 cut(s) 118, 247
MflI RGATCY 1 cut(s) 203
MlyI GAGTC 2 cut(s) 75, 281
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 6 cut(s) 57, 151, 169, 184, 218, 328
MspI CCGG 1 cut(s) 115
Mva1269I GAATGC 2 cut(s) 228, 244
MwoI GCNNNNNNNGC 1 cut(s) 185
NdeII GATC 1 cut(s) 203
NlaIII CATG 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 205
NmuCI GTSAC 2 cut(s) 117, 145
NspI RCATGY 1 cut(s) 143
PctI GAATGC 2 cut(s) 228, 244
PfeI GAWTC 1 cut(s) 161
PleI GAGTC 2 cut(s) 75, 280
PpsI GAGTC 2 cut(s) 75, 280
PspN4I GGNNCC 1 cut(s) 205
PsuI RGATCY 1 cut(s) 203
RsaI GTAC 1 cut(s) 93
RsaNI GTAC 1 cut(s) 92
Sau3AI GATC 1 cut(s) 203
SchI GAGTC 2 cut(s) 75, 281
SetI ASST 5 cut(s) 198, 268, 307, 328, 333
SfaNI GCATC 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
SspI AATATT 1 cut(s) 286
SspMI CTAG 2 cut(s) 200, 257
StyI CCWWGG 1 cut(s) 165
TaiI ACGT 1 cut(s) 328
TaqI TCGA 2 cut(s) 84, 333
TfiI GAWTC 1 cut(s) 161
TscAI CASTG 1 cut(s) 320
TseFI GTSAC 2 cut(s) 117, 145
Tsp45I GTSAC 2 cut(s) 117, 145
TspDTI ATGAA 2 cut(s) 17, 21
TspRI CASTG 1 cut(s) 320
XceI RCATGY 1 cut(s) 143
XspI CTAG 2 cut(s) 200, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.