Rroxscaffold_7G00191550

Synaptotagmin-5-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
32183686 .. 32184598
913 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00191550.1

Sequence Viewer

Length: 198 bp
ATGGAAGATGTTGGTGAAAAGCAAGGAGAACCTACTCCAATACTTTGTGACAACAAATTTGCAATTGCGATGGATAAGAATCTGGTGTTTCACAACCGAACCAAGCACATAGCTCACAAACATCACTTCATCGGTGATGCTGTTGAAGTTAATGAAATTGATGTGGTATATTGCGGGACGAGAAGATCAAGTAGCTGA

Protein Analysis

65

Amino Acids

7.35

Weight (kDa)

6.16

Isoelectric Point (pI)

57.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017871)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 174
AcsI RAATTY 1 cut(s) 56
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 2 cut(s) 113, 195
AluI AGCT 2 cut(s) 113, 195
ApoI RAATTY 1 cut(s) 56
ArsI GACNNNNNNTTYG 2 cut(s) 41, 73
AsuHPI GGTGA 2 cut(s) 26, 146
BccI CCATC 1 cut(s) 64
BmsI GCATC 1 cut(s) 127
BsaBI GATNNNNATC 1 cut(s) 78
Bse8I GATNNNNATC 1 cut(s) 78
BseJI GATNNNNATC 1 cut(s) 78
BslFI GGGAC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 185
BspACI CCGC 1 cut(s) 174
BssMI GATC 1 cut(s) 185
BstKTI GATC 1 cut(s) 188
BstMBI GATC 1 cut(s) 185
BtgZI GCGATG 1 cut(s) 83
CviJI RGCY 2 cut(s) 113, 195
CviKI_1 RGCY 2 cut(s) 113, 195
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
FaiI YATR 2 cut(s) 110, 169
FaqI GGGAC 1 cut(s) 190
FauI CCCGC 1 cut(s) 167
HinfI GANTC 1 cut(s) 79
HphI GGTGA 2 cut(s) 26, 146
HpyCH4V TGCA 1 cut(s) 62
Kzo9I GATC 1 cut(s) 185
LpnPI CCDG 1 cut(s) 68
LweI GCATC 1 cut(s) 127
MaeIII GTNAC 1 cut(s) 47
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 2 cut(s) 17, 195
MfeI CAATTG 1 cut(s) 63
MluCI AATT 3 cut(s) 56, 63, 156
MseI TTAA 1 cut(s) 150
MunI CAATTG 1 cut(s) 63
NdeII GATC 1 cut(s) 185
NmuCI GTSAC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 79
SaqAI TTAA 1 cut(s) 150
Sau3AI GATC 1 cut(s) 185
SetI ASST 3 cut(s) 34, 115, 197
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 5 cut(s) 35, 95, 115, 187, 192
Sse9I AATT 3 cut(s) 56, 63, 156
SsiI CCGC 1 cut(s) 174
TasI AATT 3 cut(s) 56, 63, 156
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 2 cut(s) 118, 168
XapI RAATTY 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.