pycom15g38670
RLK Family

cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
38435205 .. 38436222
1018 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g38670.3

Sequence Viewer

Length: 648 bp
ATGCAATGCAAACCAGTCATTCGACAGCACCAAAATGAGGCTATGGTGCCAACAACCCTAATTCACGAAAGACTTTCAAATGCAGCTACTGTGACGGAGGACATCCAGTCGAATGTTGTTTTTTCCTTATTGGCTTCCTTAAAGGACACAAATGGCACGGGAAGAATGTGCAGCCCAGAAATAGGCGTGCACCTCCAGCCTCCAACAATGTTGAAACACTACCGTTGCCAGCTGCTCAGATTGACCCAACCAAAGCAACAACCTCCAACAATCAACCAACGTTCACAACCGAGGAATACCATCAACTCATGGCCCTTCTTCGCAATAAGACTGGTACCAATCTGCCACTTGTACATGCAACAGGACATGGCTACAAAGAGGATGATTGGCCTGGGCAAGCAGTTTAATGGACTCTACTACCTCACTCCAACACAAAACCCTCATCTCACCCACCATGTCAACCGTACCTCGGCACTGTGGCACCAACGTCTTGGGCACCCATCCTCAACTCCTCTTCACTCTTTATCCCAGACCATTCCAGAAATTATTTTTGATTTTACACATGTTTGTGATGTTTGTCCTTTAGCAAAGCAAACTCGTTCATCTTTTGTTTCCAGTTCAATAAAATCAGTTCCATACACCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

216

Amino Acids

24.44

Weight (kDa)

9.65

Isoelectric Point (pI)

51.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017871)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 334
AccB1I GGYRCC 4 cut(s) 46, 334, 480, 495
AclI AACGTT 1 cut(s) 280
AfaI GTAC 3 cut(s) 336, 353, 466
AfiI CCNNNNNNNGG 3 cut(s) 37, 182, 469
AflIII ACRYGT 1 cut(s) 562
AgsI TTSAA 3 cut(s) 78, 214, 621
AhdI GACNNNNNGTC 1 cut(s) 106
AjnI CCWGG 1 cut(s) 390
AluBI AGCT 2 cut(s) 86, 232
AluI AGCT 2 cut(s) 86, 232
Alw21I GWGCWC 1 cut(s) 192
Alw44I GTGCAC 1 cut(s) 188
AlwNI CAGNNNCTG 1 cut(s) 89
AoxI GGCC 2 cut(s) 311, 388
ApaLI GTGCAC 1 cut(s) 188
ApeKI GCWGC 3 cut(s) 83, 171, 232
Asp718I GGTACC 1 cut(s) 334
AspS9I GGNCC 1 cut(s) 312
AsuHPI GGTGA 1 cut(s) 439
BaeGI GKGCMC 2 cut(s) 192, 498
BanI GGYRCC 4 cut(s) 46, 334, 480, 495
Bbv12I GWGCWC 1 cut(s) 192
BbvI GCAGC 3 cut(s) 95, 183, 219
BccI CCATC 2 cut(s) 308, 508
BciT130I CCWGG 1 cut(s) 392
BfaI CTAG 1 cut(s) 646
BisI GCNGC 3 cut(s) 84, 172, 233
BlsI GCNGC 3 cut(s) 85, 173, 234
Bme1390I CCNGG 1 cut(s) 392
BmeRI GACNNNNNGTC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 312
BmiI GGNNCC 4 cut(s) 48, 336, 482, 497
BmrFI CCNGG 1 cut(s) 392
BpmI CTGGAG 1 cut(s) 179
BsaJI CCNNGG 3 cut(s) 290, 391, 468
Bsc4I CCNNNNNNNGG 3 cut(s) 37, 182, 469
Bse1I ACTGG 4 cut(s) 14, 106, 336, 615
Bse3DI GCAATG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 392
BseDI CCNNGG 3 cut(s) 290, 391, 468
BseGI GGATG 3 cut(s) 102, 387, 500
BseLI CCNNNNNNNGG 3 cut(s) 37, 182, 469
BseMI GCAATG 1 cut(s) 11
BseMII CTCAG 1 cut(s) 250
BseNI ACTGG 4 cut(s) 14, 106, 336, 615
BseRI GAGGAG 1 cut(s) 501
BseSI GKGCMC 2 cut(s) 192, 498
BseXI GCAGC 3 cut(s) 95, 183, 219
BsgI GTGCAG 1 cut(s) 190
BshFI GGCC 2 cut(s) 313, 390
BshNI GGYRCC 4 cut(s) 46, 334, 480, 495
BsiHKAI GWGCWC 1 cut(s) 192
BslI CCNNNNNNNGG 3 cut(s) 37, 182, 469
BsnI GGCC 2 cut(s) 313, 390
Bsp1286I GDGCHC 2 cut(s) 192, 498
Bsp1407I TGTACA 1 cut(s) 351
BspANI GGCC 2 cut(s) 313, 390
BspCNI CTCAG 1 cut(s) 249
BspLI GGNNCC 4 cut(s) 48, 336, 482, 497
BspT107I GGYRCC 4 cut(s) 46, 334, 480, 495
BsrDI GCAATG 1 cut(s) 11
BsrGI TGTACA 1 cut(s) 351
BsrI ACTGG 4 cut(s) 14, 106, 336, 615
BssECI CCNNGG 3 cut(s) 290, 391, 468
Bst2UI CCWGG 1 cut(s) 392
Bst4CI ACNGT 4 cut(s) 91, 224, 464, 477
Bst6I CTCTTC 1 cut(s) 519
BstAUI TGTACA 1 cut(s) 351
BstC8I GCNNGC 3 cut(s) 188, 230, 398
BstDEI CTNAG 1 cut(s) 236
BstF5I GGATG 3 cut(s) 102, 387, 500
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstNI CCWGG 1 cut(s) 392
BstNSI RCATGY 2 cut(s) 358, 566
BstSCI CCNGG 1 cut(s) 390
BstSLI GKGCMC 2 cut(s) 192, 498
BstV1I GCAGC 3 cut(s) 95, 183, 219
BstXI CCANNNNNNTGG 1 cut(s) 491
BsuRI GGCC 2 cut(s) 313, 390
BtsCI GGATG 3 cut(s) 102, 387, 500
BtsIMutI CAGTG 1 cut(s) 473
Cac8I GCNNGC 3 cut(s) 188, 230, 398
CaiI CAGNNNCTG 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 312
Csp6I GTAC 3 cut(s) 335, 352, 465
CviAII CATG 5 cut(s) 309, 355, 367, 455, 563
CviJI RGCY 9 cut(s) 41, 86, 134, 174, 199, 232, 313, 371, 390
CviKI_1 RGCY 9 cut(s) 41, 86, 134, 174, 199, 232, 313, 371, 390
CviQI GTAC 3 cut(s) 335, 352, 465
DdeI CTNAG 1 cut(s) 236
DriI GACNNNNNGTC 1 cut(s) 106
Eam1104I CTCTTC 1 cut(s) 519
Eam1105I GACNNNNNGTC 1 cut(s) 106
EarI CTCTTC 1 cut(s) 519
EcoRII CCWGG 1 cut(s) 390
FaeI CATG 5 cut(s) 312, 358, 370, 458, 566
FaiI YATR 7 cut(s) 44, 310, 356, 368, 456, 564, 637
FatI CATG 5 cut(s) 308, 354, 366, 454, 562
Fnu4HI GCNGC 3 cut(s) 84, 172, 233
FokI GGATG 3 cut(s) 89, 394, 487
Fsp4HI GCNGC 3 cut(s) 84, 172, 233
FspBI CTAG 1 cut(s) 646
GluI GCNGC 3 cut(s) 84, 172, 233
GsuI CTGGAG 1 cut(s) 179
HaeIII GGCC 2 cut(s) 313, 390
Hin1II CATG 5 cut(s) 312, 358, 370, 458, 566
HincII GTYRAC 1 cut(s) 460
HindII GTYRAC 1 cut(s) 460
HinfI GANTC 1 cut(s) 411
HphI GGTGA 1 cut(s) 439
Hpy166II GTNNAC 3 cut(s) 190, 284, 460
Hpy188I TCNGA 1 cut(s) 239
Hpy188III TCNNGA 2 cut(s) 65, 539
Hpy8I GTNNAC 3 cut(s) 190, 284, 460
HpyAV CCTTC 1 cut(s) 325
HpyCH4III ACNGT 4 cut(s) 91, 224, 464, 477
HpyCH4IV ACGT 2 cut(s) 280, 487
HpyCH4V TGCA 6 cut(s) 4, 9, 83, 171, 190, 358
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpyF3I CTNAG 1 cut(s) 236
HpySE526I ACGT 2 cut(s) 280, 487
Hsp92II CATG 5 cut(s) 312, 358, 370, 458, 566
KpnI GGTACC 1 cut(s) 338
Lsp1109I GCAGC 3 cut(s) 95, 183, 219
MaeI CTAG 1 cut(s) 646
MaeII ACGT 2 cut(s) 280, 487
MaeIII GTNAC 1 cut(s) 91
MboII GAAGA 3 cut(s) 174, 310, 506
MhlI GDGCHC 2 cut(s) 192, 498
MluCI AATT 2 cut(s) 60, 543
MlyI GAGTC 1 cut(s) 405
MmeI TCCRAC 3 cut(s) 227, 290, 452
MseI TTAA 2 cut(s) 140, 405
MslI CAYNNNNRTG 2 cut(s) 33, 567
MspA1I CMGCKG 1 cut(s) 232
MspR9I CCNGG 1 cut(s) 392
MvaI CCWGG 1 cut(s) 392
MwoI GCNNNNNNNGC 1 cut(s) 196
NlaIII CATG 5 cut(s) 312, 358, 370, 458, 566
NlaIV GGNNCC 4 cut(s) 48, 336, 482, 497
NmeAIII GCCGAG 1 cut(s) 449
NmuCI GTSAC 1 cut(s) 91
NspI RCATGY 2 cut(s) 358, 566
PciI ACATGT 1 cut(s) 562
PkrI GCNGC 3 cut(s) 85, 173, 234
PleI GAGTC 1 cut(s) 405
PpsI GAGTC 1 cut(s) 405
PscI ACATGT 1 cut(s) 562
Psp1406I AACGTT 1 cut(s) 280
Psp6I CCWGG 1 cut(s) 390
PspGI CCWGG 1 cut(s) 390
PspN4I GGNNCC 4 cut(s) 48, 336, 482, 497
PspPI GGNCC 1 cut(s) 312
PstNI CAGNNNCTG 1 cut(s) 89
PvuII CAGCTG 1 cut(s) 232
RsaI GTAC 3 cut(s) 336, 353, 466
RsaNI GTAC 3 cut(s) 335, 352, 465
RseI CAYNNNNRTG 2 cut(s) 33, 567
SaqAI TTAA 2 cut(s) 140, 405
SatI GCNGC 3 cut(s) 84, 172, 233
Sau96I GGNCC 1 cut(s) 312
SchI GAGTC 1 cut(s) 405
ScrFI CCNGG 1 cut(s) 392
SduI GDGCHC 2 cut(s) 192, 498
SetI ASST 8 cut(s) 88, 195, 234, 265, 283, 423, 470, 490
SmiMI CAYNNNNRTG 2 cut(s) 33, 567
Sse9I AATT 2 cut(s) 60, 543
SspMI CTAG 1 cut(s) 646
StyD4I CCNGG 1 cut(s) 390
TaaI ACNGT 4 cut(s) 91, 224, 464, 477
TaiI ACGT 2 cut(s) 283, 490
TaqI TCGA 2 cut(s) 22, 110
TasI AATT 2 cut(s) 60, 543
TatI WGTACW 1 cut(s) 351
Tru1I TTAA 2 cut(s) 140, 405
Tru9I TTAA 2 cut(s) 140, 405
TscAI CASTG 1 cut(s) 480
TseFI GTSAC 1 cut(s) 91
TseI GCWGC 3 cut(s) 83, 171, 232
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 591
TspGWI ACGGA 1 cut(s) 110
TspRI CASTG 1 cut(s) 480
VneI GTGCAC 1 cut(s) 188
XceI RCATGY 2 cut(s) 358, 566
XspI CTAG 1 cut(s) 646
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.