pycom16g19280

Small acidic protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0014128
Physical Location & Seq
Forward (+)
16255054 .. 16255347
294 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g19280.1

Sequence Viewer

Length: 294 bp
ATGTCGTCGTCAAGAGCAAGACAAATTAAAAAAGCGAGCACTCCGGCAGAAAGCCAAAACGTGAGACGCTCCATAGCCATAGCTTCCGCAAGGCAGAGGCAATTTGAAGTGATGAGGCCAACGGCGATGGACTTCTTCAGCGACATGGACGATCAGGGCTCCACCATGGCCATGGACGTTGACGACGTCGACCCAATCGAGGCGTTCGGCGAGGGCATCAGCGAGAGCAAGCTGGCCGGCGCCGATTTCTTCAACTCCTTCCAAGACGATTTTGACGACACCGACATCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.77

Weight (kDa)

4.22

Isoelectric Point (pI)

44.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014128)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24280 AT4G13520 AT4G13520
fragaria_vesca FvH4_4g05200 FvH4_4g05200
prunus_persica Prupe.1G052700_v2.0.a1
pyrus_communis pycom16g19280
rosa_chinensis RchiOBHm_Chr4g0396111
rosa_laevigata RLG00000009571
rosa_multiflora Rmu_co8348141.1_g000001 Rmu_sc0007010.1_g000012 Rmu_sc0009634.1_g000009
rosa_roxburghii Rroxscaffold_5G00340910
rosa_rugosa Rorug03G0352300
rosa_samantha Rh4BG064300 Rh4CG070900
rosa_wichuraiana Rw4G005340

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 189
AccB1I GGYRCC 1 cut(s) 239
AccI GTMKAC 1 cut(s) 189
AciI CCGC 1 cut(s) 87
AcoI YGGCCR 2 cut(s) 168, 234
AcuI CTGAAG 1 cut(s) 121
AcyI GRCGYC 2 cut(s) 186, 240
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 2 cut(s) 107, 253
AluBI AGCT 2 cut(s) 83, 232
AluI AGCT 2 cut(s) 83, 232
Alw21I GWGCWC 1 cut(s) 41
Alw26I GTCTC 1 cut(s) 58
AoxI GGCC 3 cut(s) 116, 168, 234
AspLEI GCGC 1 cut(s) 242
BalI TGGCCA 1 cut(s) 170
BanI GGYRCC 1 cut(s) 239
BanII GRGCYC 1 cut(s) 161
Bbv12I GWGCWC 1 cut(s) 41
BccI CCATC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 138
BcoDI GTCTC 1 cut(s) 58
BfoI RGCGCY 1 cut(s) 243
BmiI GGNNCC 2 cut(s) 160, 241
BmsI GCATC 1 cut(s) 225
BsaHI GRCGYC 2 cut(s) 186, 240
BsaJI CCNNGG 2 cut(s) 165, 171
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse118I RCCGGY 1 cut(s) 236
BseDI CCNNGG 2 cut(s) 165, 171
BseLI CCNNNNNNNGG 1 cut(s) 199
BshFI GGCC 3 cut(s) 118, 170, 236
BshNI GGYRCC 1 cut(s) 239
BsiHKAI GWGCWC 1 cut(s) 41
BsiSI CCGG 2 cut(s) 44, 237
BslI CCNNNNNNNGG 1 cut(s) 199
BsmAI GTCTC 1 cut(s) 58
BsmBI CGTCTC 1 cut(s) 58
BsnI GGCC 3 cut(s) 118, 170, 236
Bsp1286I GDGCHC 2 cut(s) 41, 161
Bsp143I GATC 1 cut(s) 151
Bsp19I CCATGG 2 cut(s) 165, 171
BspACI CCGC 1 cut(s) 87
BspANI GGCC 3 cut(s) 118, 170, 236
BspLI GGNNCC 2 cut(s) 160, 241
BspT107I GGYRCC 1 cut(s) 239
BsrFI RCCGGY 1 cut(s) 236
BssAI RCCGGY 1 cut(s) 236
BssECI CCNNGG 2 cut(s) 165, 171
BssMI GATC 1 cut(s) 151
BssNI GRCGYC 2 cut(s) 186, 240
BssT1I CCWWGG 2 cut(s) 165, 171
BstACI GRCGYC 2 cut(s) 186, 240
BstC8I GCNNGC 4 cut(s) 37, 230, 234, 238
BstDSI CCRYGG 2 cut(s) 165, 171
BstH2I RGCGCY 1 cut(s) 243
BstHHI GCGC 1 cut(s) 242
BstKTI GATC 1 cut(s) 154
BstMAI GTCTC 1 cut(s) 58
BstMBI GATC 1 cut(s) 151
BstXI CCANNNNNNTGG 1 cut(s) 172
BsuRI GGCC 3 cut(s) 118, 170, 236
BtgI CCRYGG 2 cut(s) 165, 171
BtgZI GCGATG 1 cut(s) 140
Cac8I GCNNGC 4 cut(s) 37, 230, 234, 238
CfoI GCGC 1 cut(s) 242
Cfr10I RCCGGY 1 cut(s) 236
CseI GACGC 1 cut(s) 75
CviAII CATG 3 cut(s) 145, 166, 172
CviJI RGCY 8 cut(s) 54, 77, 83, 118, 159, 170, 232, 236
CviKI_1 RGCY 8 cut(s) 54, 77, 83, 118, 159, 170, 232, 236
DinI GGCGCC 1 cut(s) 241
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
EaeI YGGCCR 2 cut(s) 168, 234
Eco130I CCWWGG 2 cut(s) 165, 171
Eco24I GRGCYC 1 cut(s) 161
Eco57I CTGAAG 1 cut(s) 121
EcoT14I CCWWGG 2 cut(s) 165, 171
EcoT38I GRGCYC 1 cut(s) 161
EgeI GGCGCC 1 cut(s) 241
EheI GGCGCC 1 cut(s) 241
ErhI CCWWGG 2 cut(s) 165, 171
Esp3I CGTCTC 1 cut(s) 58
FaeI CATG 3 cut(s) 148, 169, 175
FaiI YATR 5 cut(s) 74, 80, 146, 167, 173
FatI CATG 3 cut(s) 144, 165, 171
FblI GTMKAC 1 cut(s) 189
FriOI GRGCYC 1 cut(s) 161
GlaI GCGC 1 cut(s) 241
HaeII RGCGCY 1 cut(s) 243
HaeIII GGCC 3 cut(s) 118, 170, 236
HapII CCGG 2 cut(s) 44, 237
HgaI GACGC 1 cut(s) 75
HhaI GCGC 1 cut(s) 242
Hin1I GRCGYC 2 cut(s) 186, 240
Hin1II CATG 3 cut(s) 148, 169, 175
Hin6I GCGC 1 cut(s) 240
HinP1I GCGC 1 cut(s) 240
HincII GTYRAC 2 cut(s) 181, 190
HindII GTYRAC 2 cut(s) 181, 190
HpaII CCGG 2 cut(s) 44, 237
Hpy166II GTNNAC 2 cut(s) 181, 190
Hpy188III TCNNGA 1 cut(s) 12
Hpy8I GTNNAC 2 cut(s) 181, 190
Hpy99I CGWCG 3 cut(s) 10, 188, 191
HpyAV CCTTC 1 cut(s) 268
HpyCH4IV ACGT 3 cut(s) 60, 177, 186
HpySE526I ACGT 3 cut(s) 60, 177, 186
Hsp92I GRCGYC 2 cut(s) 186, 240
Hsp92II CATG 3 cut(s) 148, 169, 175
HspAI GCGC 1 cut(s) 240
KasI GGCGCC 1 cut(s) 239
KroI GCCGGC 1 cut(s) 236
KroNI GCCGGC 1 cut(s) 238
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 2 cut(s) 74, 164
LpnPI CCDG 4 cut(s) 57, 140, 218, 250
LweI GCATC 1 cut(s) 225
MaeII ACGT 3 cut(s) 60, 177, 186
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 127, 241
MhlI GDGCHC 2 cut(s) 41, 161
MlsI TGGCCA 1 cut(s) 170
MluCI AATT 2 cut(s) 24, 101
MluNI TGGCCA 1 cut(s) 170
Mly113I GGCGCC 1 cut(s) 240
MnlI CCTC 4 cut(s) 90, 108, 193, 205
Mox20I TGGCCA 1 cut(s) 170
MroNI GCCGGC 1 cut(s) 236
MscI TGGCCA 1 cut(s) 170
MseI TTAA 1 cut(s) 27
MslI CAYNNNNRTG 1 cut(s) 170
Msp20I TGGCCA 1 cut(s) 170
MspI CCGG 2 cut(s) 44, 237
NaeI GCCGGC 1 cut(s) 238
NarI GGCGCC 1 cut(s) 240
NcoI CCATGG 2 cut(s) 165, 171
NdeII GATC 1 cut(s) 151
NgoMIV GCCGGC 1 cut(s) 236
NlaIII CATG 3 cut(s) 148, 169, 175
NlaIV GGNNCC 2 cut(s) 160, 241
PcsI WCGNNNNNNNCGW 3 cut(s) 183, 195, 273
PdiI GCCGGC 1 cut(s) 238
PflFI GACNNNGTC 1 cut(s) 185
PluTI GGCGCC 1 cut(s) 243
PspN4I GGNNCC 2 cut(s) 160, 241
PsyI GACNNNGTC 1 cut(s) 185
RseI CAYNNNNRTG 1 cut(s) 170
SalI GTCGAC 1 cut(s) 188
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 151
SduI GDGCHC 2 cut(s) 41, 161
SetI ASST 5 cut(s) 63, 85, 180, 189, 234
SfaNI GCATC 1 cut(s) 225
SfoI GGCGCC 1 cut(s) 241
SmiMI CAYNNNNRTG 1 cut(s) 170
Sse9I AATT 2 cut(s) 24, 101
SsiI CCGC 1 cut(s) 87
SspDI GGCGCC 1 cut(s) 239
StyI CCWWGG 2 cut(s) 165, 171
TaiI ACGT 3 cut(s) 63, 180, 189
TaqI TCGA 2 cut(s) 189, 198
TasI AATT 2 cut(s) 24, 101
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
Tth111I GACNNNGTC 1 cut(s) 185
XcmI CCANNNNNNNNNTGG 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 189
ZraI GACGTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.