pycom16g19650

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0017508
Physical Location & Seq
Reverse (-)
16851788 .. 16852180
393 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 393 bp
ATGGCTGATTACGGGGTGACGGGCTTTTTCCTTCTTCTGCTCTCGCTGTCCATCTGCAGCTCAATGGCTGATTACCGGGTGACCGTTTTTAACGATTTGGCTCAAAACACCAACCTGAATGTTCATTGTCAAGCTGCAGGTGTAGATCCGAGCACTCACTCGATCCTATTTTTGCAAGACTTCAGCTGGACCATCAACATTAACACTACTCATGTGTTATCTTGTGACATGAGATGGGGTAGCGTAAAGGGTCATTTCGACATCTTTGATGCTAAAAGAGATGCAACTAGATGTGCTAGAAACTGGTGCGCTTGGCGTGTAAAACAGGACGGCTTGTATCTCTTCATCGAGGCGCATAAGAGGTTGGAGTTGCAGTTTACATGGCCACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

131

Amino Acids

14.95

Weight (kDa)

6.56

Isoelectric Point (pI)

33.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 27 - 128 1.2e-20 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017508)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24065 AT3G24068
prunus_persica Prupe.1G060200_v2.0.a1
pyrus_communis pycom16g19650
rosa_chinensis RchiOBHm_Chr4g0396871
rosa_laevigata RLG00000009498
rosa_rugosa Rorug03G0346800
rosa_samantha Rh4AG074200 Rh4BG070900 Rh4CG079000 Rh4DG068200
rosa_wichuraiana Rw4G005970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 128
Acc36I ACCTGC 1 cut(s) 128
AclWI GGATC 2 cut(s) 140, 157
AcoI YGGCCR 1 cut(s) 383
AcuI CTGAAG 1 cut(s) 166
AluBI AGCT 3 cut(s) 60, 134, 186
AluI AGCT 3 cut(s) 60, 134, 186
Alw21I GWGCWC 1 cut(s) 155
AlwI GGATC 2 cut(s) 140, 157
AoxI GGCC 1 cut(s) 383
ApeKI GCWGC 2 cut(s) 57, 134
AspLEI GCGC 2 cut(s) 311, 355
AspS9I GGNCC 1 cut(s) 189
AsuC2I CCSGG 1 cut(s) 77
AsuHPI GGTGA 2 cut(s) 28, 91
AvaII GGWCC 1 cut(s) 189
BalI TGGCCA 1 cut(s) 385
Bbv12I GWGCWC 1 cut(s) 155
BbvI GCAGC 2 cut(s) 69, 121
BccI CCATC 3 cut(s) 59, 200, 228
BceAI ACGGC 1 cut(s) 346
BcnI CCSGG 1 cut(s) 77
BfaI CTAG 2 cut(s) 288, 297
BfmI CTRYAG 2 cut(s) 55, 135
BfuAI ACCTGC 1 cut(s) 128
BisI GCNGC 2 cut(s) 58, 135
BlsI GCNGC 2 cut(s) 59, 136
Bme1390I CCNGG 1 cut(s) 77
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 77
BmsI GCATC 2 cut(s) 259, 271
BpuMI CCSGG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 359, 389
Bse1I ACTGG 1 cut(s) 308
BseNI ACTGG 1 cut(s) 308
BseXI GCAGC 2 cut(s) 69, 121
BshFI GGCC 1 cut(s) 385
BsiHKAI GWGCWC 1 cut(s) 155
BsiSI CCGG 1 cut(s) 76
BsnI GGCC 1 cut(s) 385
Bsp1286I GDGCHC 1 cut(s) 155
Bsp143I GATC 2 cut(s) 145, 162
BspANI GGCC 1 cut(s) 385
BspMAI CTGCAG 2 cut(s) 59, 139
BspMI ACCTGC 1 cut(s) 128
BspPI GGATC 2 cut(s) 140, 157
BsrI ACTGG 1 cut(s) 308
BssMI GATC 2 cut(s) 145, 162
Bst4CI ACNGT 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 347
BstEII GGTNACC 1 cut(s) 79
BstHHI GCGC 2 cut(s) 311, 355
BstKTI GATC 2 cut(s) 148, 165
BstMBI GATC 2 cut(s) 145, 162
BstPI GGTNACC 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 75
BstSFI CTRYAG 2 cut(s) 55, 135
BstV1I GCAGC 2 cut(s) 69, 121
BstX2I RGATCY 1 cut(s) 145
BstYI RGATCY 1 cut(s) 145
BsuRI GGCC 1 cut(s) 385
BveI ACCTGC 1 cut(s) 128
CfoI GCGC 2 cut(s) 311, 355
Cfr13I GGNCC 1 cut(s) 189
CviAII CATG 3 cut(s) 212, 229, 381
CviJI RGCY 9 cut(s) 5, 24, 60, 68, 101, 134, 186, 333, 385
CviKI_1 RGCY 9 cut(s) 5, 24, 60, 68, 101, 134, 186, 333, 385
DpnI GATC 2 cut(s) 147, 164
DpnII GATC 2 cut(s) 145, 162
EaeI YGGCCR 1 cut(s) 383
Eam1104I CTCTTC 1 cut(s) 347
EarI CTCTTC 1 cut(s) 347
Eco47I GGWCC 1 cut(s) 189
Eco57I CTGAAG 1 cut(s) 166
Eco91I GGTNACC 1 cut(s) 79
EcoO65I GGTNACC 1 cut(s) 79
FaeI CATG 3 cut(s) 215, 232, 384
FaiI YATR 4 cut(s) 213, 230, 357, 382
FatI CATG 3 cut(s) 211, 228, 380
Fnu4HI GCNGC 2 cut(s) 58, 135
Fsp4HI GCNGC 2 cut(s) 58, 135
FspBI CTAG 2 cut(s) 288, 297
GlaI GCGC 2 cut(s) 310, 354
GluI GCNGC 2 cut(s) 58, 135
HaeIII GGCC 1 cut(s) 385
HapII CCGG 1 cut(s) 76
HhaI GCGC 2 cut(s) 311, 355
Hin1II CATG 3 cut(s) 215, 232, 384
Hin6I GCGC 2 cut(s) 309, 353
HinP1I GCGC 2 cut(s) 309, 353
HpaII CCGG 1 cut(s) 76
HphI GGTGA 2 cut(s) 28, 91
Hpy166II GTNNAC 1 cut(s) 378
Hpy188I TCNGA 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 378
HpyAV CCTTC 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 5 cut(s) 57, 137, 175, 284, 373
Hsp92II CATG 3 cut(s) 215, 232, 384
HspAI GCGC 2 cut(s) 309, 353
Kzo9I GATC 2 cut(s) 145, 162
LpnPI CCDG 6 cut(s) 89, 123, 128, 172, 289, 311
Lsp1109I GCAGC 2 cut(s) 69, 121
LweI GCATC 2 cut(s) 259, 271
MaeI CTAG 2 cut(s) 288, 297
MaeIII GTNAC 3 cut(s) 16, 79, 224
MalI GATC 2 cut(s) 147, 164
MboI GATC 2 cut(s) 145, 162
MboII GAAGA 2 cut(s) 26, 334
MflI RGATCY 1 cut(s) 145
MhlI GDGCHC 1 cut(s) 155
MlsI TGGCCA 1 cut(s) 385
MluNI TGGCCA 1 cut(s) 385
MmeI TCCRAC 1 cut(s) 345
MnlI CCTC 2 cut(s) 343, 354
Mox20I TGGCCA 1 cut(s) 385
MscI TGGCCA 1 cut(s) 385
MseI TTAA 2 cut(s) 90, 201
Msp20I TGGCCA 1 cut(s) 385
MspA1I CMGCKG 1 cut(s) 186
MspI CCGG 1 cut(s) 76
MspR9I CCNGG 1 cut(s) 77
NciI CCSGG 1 cut(s) 77
NdeII GATC 2 cut(s) 145, 162
NlaIII CATG 3 cut(s) 215, 232, 384
NmuCI GTSAC 3 cut(s) 16, 79, 224
PaqCI CACCTGC 1 cut(s) 128
PkrI GCNGC 2 cut(s) 59, 136
PspEI GGTNACC 1 cut(s) 79
PspPI GGNCC 1 cut(s) 189
PstI CTGCAG 2 cut(s) 59, 139
PsuI RGATCY 1 cut(s) 145
PvuII CAGCTG 1 cut(s) 186
SaqAI TTAA 2 cut(s) 90, 201
SatI GCNGC 2 cut(s) 58, 135
Sau3AI GATC 2 cut(s) 145, 162
Sau96I GGNCC 1 cut(s) 189
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 1 cut(s) 155
SetI ASST 6 cut(s) 62, 117, 136, 142, 188, 365
SfaNI GCATC 2 cut(s) 259, 271
SfcI CTRYAG 2 cut(s) 55, 135
SinI GGWCC 1 cut(s) 189
SspMI CTAG 2 cut(s) 288, 297
StyD4I CCNGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 85
TaqI TCGA 3 cut(s) 161, 258, 348
Tru1I TTAA 2 cut(s) 90, 201
Tru9I TTAA 2 cut(s) 90, 201
TseFI GTSAC 3 cut(s) 16, 79, 224
TseI GCWGC 2 cut(s) 57, 134
Tsp45I GTSAC 3 cut(s) 16, 79, 224
TspDTI ATGAA 2 cut(s) 113, 334
VpaK11BI GGWCC 1 cut(s) 189
XspI CTAG 2 cut(s) 288, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.